Incidental Mutation 'R7524:Olfr1507'
ID582877
Institutional Source Beutler Lab
Gene Symbol Olfr1507
Ensembl Gene ENSMUSG00000059887
Gene Nameolfactory receptor 1507
SynonymsMOR244-1, MOR28, GA_x6K02T2RJGY-491851-492792
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7524 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52488791-52495749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52490293 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 224 (I224V)
Ref Sequence ENSEMBL: ENSMUSP00000146152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073571] [ENSMUST00000205963] [ENSMUST00000206062] [ENSMUST00000206069] [ENSMUST00000206931]
Predicted Effect probably damaging
Transcript: ENSMUST00000073571
AA Change: I224V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073260
Gene: ENSMUSG00000059887
AA Change: I224V

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 305 3.6e-9 PFAM
Pfam:7tm_1 44 290 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205963
Predicted Effect probably damaging
Transcript: ENSMUST00000206062
AA Change: I224V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000206069
Predicted Effect probably benign
Transcript: ENSMUST00000206931
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pcdhgb4 A T 18: 37,721,608 D352V probably benign Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Olfr1507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr1507 APN 14 52490748 missense probably damaging 1.00
IGL01367:Olfr1507 APN 14 52490167 missense probably benign 0.42
IGL01664:Olfr1507 APN 14 52490545 missense probably benign 0.01
IGL02890:Olfr1507 APN 14 52490911 missense probably benign
IGL03108:Olfr1507 APN 14 52490076 missense probably damaging 0.97
IGL03184:Olfr1507 APN 14 52490923 missense probably benign 0.20
R0563:Olfr1507 UTSW 14 52490257 nonsense probably null
R1080:Olfr1507 UTSW 14 52490585 nonsense probably null
R1558:Olfr1507 UTSW 14 52490146 missense probably benign 0.26
R1653:Olfr1507 UTSW 14 52490772 missense probably damaging 1.00
R1714:Olfr1507 UTSW 14 52490414 unclassified probably null
R1720:Olfr1507 UTSW 14 52490594 nonsense probably null
R3430:Olfr1507 UTSW 14 52490425 missense possibly damaging 0.92
R4995:Olfr1507 UTSW 14 52490531 nonsense probably null
R5954:Olfr1507 UTSW 14 52490167 missense probably benign 0.42
R6183:Olfr1507 UTSW 14 52490731 missense probably benign 0.05
R6518:Olfr1507 UTSW 14 52490620 missense probably damaging 1.00
R6651:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6652:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6653:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R7385:Olfr1507 UTSW 14 52490181 missense probably damaging 1.00
X0025:Olfr1507 UTSW 14 52490466 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCACTCTTCATGTCCTC -3'
(R):5'- ACCATCAAGCTGCCCTACTG -3'

Sequencing Primer
(F):5'- CATGTCCTCATTCCTAAAGGTGTAG -3'
(R):5'- GCCCTACTGTGGTCCTAATGAG -3'
Posted On2019-10-17