Incidental Mutation 'R7524:Pcdhgb4'
ID582885
Institutional Source Beutler Lab
Gene Symbol Pcdhgb4
Ensembl Gene ENSMUSG00000103585
Gene Nameprotocadherin gamma subfamily B, 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7524 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37720369-37841870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37721608 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 352 (D352V)
Ref Sequence ENSEMBL: ENSMUSP00000142227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193476] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193476
SMART Domains Protein: ENSMUSP00000142126
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 47 133 7.6e-5 SMART
CA 157 242 1.6e-21 SMART
CA 266 347 1.6e-25 SMART
CA 371 452 4.5e-25 SMART
CA 476 562 6.6e-27 SMART
CA 593 671 1.7e-17 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
AA Change: D352V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585
AA Change: D352V

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. This particular family member is expressed in fibroblasts and is thought to play a role in wound healing in response to injury. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,360 C353Y probably damaging Het
Afap1l2 T A 19: 56,918,111 E452V probably damaging Het
AI464131 C A 4: 41,498,779 V284L probably benign Het
Ak6 A G 13: 100,663,907 D45G probably benign Het
Arhgap17 G A 7: 123,306,420 P334L probably damaging Het
Asns G T 6: 7,677,259 probably null Het
Bend7 A G 2: 4,799,980 T424A probably benign Het
Btbd2 C T 10: 80,646,444 E241K probably damaging Het
Commd2 A C 3: 57,650,148 L99W probably damaging Het
Cpne9 A T 6: 113,302,064 D473V probably damaging Het
Cuzd1 A T 7: 131,311,618 F423L probably damaging Het
Cyp2d9 T C 15: 82,455,945 F390L probably damaging Het
Dcaf5 T A 12: 80,376,696 Q234L probably benign Het
Dennd3 T G 15: 73,524,246 Y201* probably null Het
Dnah17 T C 11: 118,121,481 D485G probably benign Het
Dnah5 A T 15: 28,297,066 T1469S possibly damaging Het
Dnah6 T C 6: 73,118,099 D2167G probably damaging Het
Dst T C 1: 34,291,893 V4921A possibly damaging Het
Ephb2 A G 4: 136,659,709 Y736H probably damaging Het
Eri2 C G 7: 119,785,749 V510L probably benign Het
Eya2 G A 2: 165,769,326 probably null Het
Fam208a T A 14: 27,466,203 C869S probably damaging Het
Fastkd5 G T 2: 130,616,128 Q181K probably benign Het
Fcgbp T C 7: 28,102,966 S1440P probably damaging Het
Fkbp9 G A 6: 56,868,740 V354M probably damaging Het
Frmpd1 T A 4: 45,271,181 S304T probably benign Het
Gtf2a2 T A 9: 70,015,347 Y3* probably null Het
Hagh G A 17: 24,861,340 V226I probably benign Het
Hemk1 T A 9: 107,328,285 I293F probably benign Het
Kcna3 A G 3: 107,037,207 E262G probably damaging Het
Kcnt2 A T 1: 140,584,055 T983S probably damaging Het
Klhdc3 A T 17: 46,678,414 H7Q probably damaging Het
Knl1 A T 2: 119,065,979 Q94L probably damaging Het
Krt12 T C 11: 99,419,659 D224G probably damaging Het
Lats1 T A 10: 7,701,978 S289T possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map1a G A 2: 121,289,812 V60M probably damaging Het
Mms22l T A 4: 24,536,138 F536I possibly damaging Het
Ms4a14 T C 19: 11,303,836 T453A unknown Het
Muc3a A C 5: 137,210,563 I151S probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1019 T A 2: 85,841,357 M145L probably benign Het
Olfr1217 T A 2: 89,023,971 I11L probably benign Het
Olfr1233 A G 2: 89,339,877 C142R probably benign Het
Olfr1507 T C 14: 52,490,293 I224V probably damaging Het
Olfr5 T C 7: 6,480,587 N190D probably benign Het
Olfr8 T A 10: 78,955,491 Y95* probably null Het
Pced1a A G 2: 130,422,028 F235L probably benign Het
Pclo A G 5: 14,678,303 I2392V unknown Het
Pld1 A T 3: 28,024,321 D43V possibly damaging Het
Ppp1r1b C A 11: 98,350,894 A51D possibly damaging Het
Prr23a1 T A 9: 98,842,864 L93H probably damaging Het
Psg20 T C 7: 18,684,659 D61G probably benign Het
Rab40b T A 11: 121,388,052 I31F probably damaging Het
Rasd2 T C 8: 75,222,081 F212L probably benign Het
Rbl2 A G 8: 91,115,193 I1006V probably benign Het
Sema6c A G 3: 95,167,060 E59G probably benign Het
Slc22a2 G T 17: 12,606,057 V269L possibly damaging Het
Slc2a1 C T 4: 119,132,612 P149S probably damaging Het
Smad4 T G 18: 73,675,871 E108D probably damaging Het
Sorbs2 T A 8: 45,795,656 I648K probably benign Het
Suclg1 A T 6: 73,263,841 I118F probably damaging Het
Tet2 A G 3: 133,480,229 I1149T probably benign Het
Tfr2 T A 5: 137,571,489 Y82* probably null Het
Tfr2 G T 5: 137,583,489 V613L probably benign Het
Tg A T 15: 66,696,161 M1305L probably benign Het
Tmem176a A T 6: 48,844,105 M170L probably benign Het
Trim71 T C 9: 114,513,162 N684S probably benign Het
Tspan9 A G 6: 127,965,251 I212T probably benign Het
Ttn A G 2: 76,942,975 V2361A possibly damaging Het
Uqcrc1 C T 9: 108,936,759 T14M possibly damaging Het
Vmn2r11 T C 5: 109,053,982 I219V probably benign Het
Vmn2r76 T C 7: 86,225,369 H800R probably benign Het
Vmn2r76 C T 7: 86,230,166 G309R probably benign Het
Xpc A T 6: 91,499,531 C529S probably benign Het
Zfp455 T A 13: 67,207,624 S254T possibly damaging Het
Zfp746 T C 6: 48,064,889 H301R possibly damaging Het
Zyg11a A T 4: 108,192,074 I490N probably damaging Het
Other mutations in Pcdhgb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5602:Pcdhgb4 UTSW 18 37721644 missense probably damaging 0.97
R6236:Pcdhgb4 UTSW 18 37721292 missense probably damaging 1.00
R6326:Pcdhgb4 UTSW 18 37722456 missense probably benign 0.40
R6425:Pcdhgb4 UTSW 18 37721587 missense possibly damaging 0.69
R6619:Pcdhgb4 UTSW 18 37721684 missense probably damaging 1.00
R6749:Pcdhgb4 UTSW 18 37721229 missense possibly damaging 0.52
R6752:Pcdhgb4 UTSW 18 37720651 missense probably damaging 0.99
R7027:Pcdhgb4 UTSW 18 37721362 missense probably damaging 1.00
R7145:Pcdhgb4 UTSW 18 37721790 missense probably benign 0.00
R7158:Pcdhgb4 UTSW 18 37720885 missense probably damaging 1.00
R7389:Pcdhgb4 UTSW 18 37722363 missense probably damaging 1.00
R7557:Pcdhgb4 UTSW 18 37722794 nonsense probably null
RF015:Pcdhgb4 UTSW 18 37721802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTCAGTGAAGCTGGCC -3'
(R):5'- TCTGCTCACGATCTAGAACTCC -3'

Sequencing Primer
(F):5'- GCTGGCCAGGTTACCCAATTTAAC -3'
(R):5'- GATCTAGAACTCCATCCGTCACTAG -3'
Posted On2019-10-17