Incidental Mutation 'R7525:Olfr1335'
ID582903
Institutional Source Beutler Lab
Gene Symbol Olfr1335
Ensembl Gene ENSMUSG00000066061
Gene Nameolfactory receptor 1335
SynonymsGA_x6K02T2QD9B-18723799-18724749, GA_x6K02T2QD9B-18726774-18727577, MOR259-12, MOR259-5, Olfr1334-ps1, Olfr1335
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7525 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118808797-118809944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118809494 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 123 (F123L)
Ref Sequence ENSEMBL: ENSMUSP00000151219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084313] [ENSMUST00000219094]
Predicted Effect probably damaging
Transcript: ENSMUST00000084313
AA Change: F107L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081339
Gene: ENSMUSG00000066061
AA Change: F107L

DomainStartEndE-ValueType
Pfam:7tm_4 50 326 2.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 54 323 3.7e-8 PFAM
Pfam:7tm_1 60 309 2.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219094
AA Change: F123L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rsf1 C CGGCGGCGGG 7: 97,579,935 probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Olfr1335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr1335 APN 4 118809456 missense probably damaging 0.98
IGL02481:Olfr1335 APN 4 118809499 missense probably benign 0.01
IGL02483:Olfr1335 APN 4 118809499 missense probably benign 0.01
R0058:Olfr1335 UTSW 4 118809480 missense probably benign
R0069:Olfr1335 UTSW 4 118809690 missense probably damaging 1.00
R0357:Olfr1335 UTSW 4 118809417 missense probably damaging 1.00
R1274:Olfr1335 UTSW 4 118809396 missense probably benign 0.01
R1432:Olfr1335 UTSW 4 118809238 missense probably benign 0.00
R2305:Olfr1335 UTSW 4 118808861 missense probably benign 0.35
R2368:Olfr1335 UTSW 4 118809822 missense probably benign
R3842:Olfr1335 UTSW 4 118809255 missense probably damaging 1.00
R3980:Olfr1335 UTSW 4 118809303 missense probably benign 0.22
R4722:Olfr1335 UTSW 4 118808949 missense probably damaging 0.99
R5074:Olfr1335 UTSW 4 118808860 missense possibly damaging 0.82
R5439:Olfr1335 UTSW 4 118809363 missense possibly damaging 0.95
R5930:Olfr1335 UTSW 4 118809378 missense probably benign 0.01
R6917:Olfr1335 UTSW 4 118809129 missense probably damaging 1.00
R7287:Olfr1335 UTSW 4 118809742 missense probably benign 0.01
R7717:Olfr1335 UTSW 4 118808933 missense probably damaging 0.99
X0023:Olfr1335 UTSW 4 118809621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTAGTGGTTGACCCTGTTG -3'
(R):5'- CATCATGCTGGTATGCCTGG -3'

Sequencing Primer
(F):5'- CCACAATATGGCAGACTCATGGTG -3'
(R):5'- ATGCTGGTATGCCTGGACACAC -3'
Posted On2019-10-17