Incidental Mutation 'R7525:Fblim1'
ID582905
Institutional Source Beutler Lab
Gene Symbol Fblim1
Ensembl Gene ENSMUSG00000006219
Gene Namefilamin binding LIM protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7525 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141576062-141606096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141590080 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 98 (L98H)
Ref Sequence ENSEMBL: ENSMUSP00000006381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006381] [ENSMUST00000105784] [ENSMUST00000105785] [ENSMUST00000127455] [ENSMUST00000129602] [ENSMUST00000130181] [ENSMUST00000131317] [ENSMUST00000141518] [ENSMUST00000147764] [ENSMUST00000147785] [ENSMUST00000153189]
Predicted Effect probably damaging
Transcript: ENSMUST00000006381
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006381
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105784
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101410
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105785
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101411
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127455
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120028
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-9 PDB
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129602
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118647
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-9 PDB
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130181
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115992
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131317
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116395
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000141518
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123669
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147764
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120600
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147785
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114313
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 5e-9 PDB
low complexity region 86 120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153189
AA Change: L98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123322
Gene: ENSMUSG00000006219
AA Change: L98H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit severe osteopenia with decreased osteoblasts and increased osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Fblim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02634:Fblim1 APN 4 141583111 missense probably benign 0.43
IGL03036:Fblim1 APN 4 141583124 missense possibly damaging 0.65
IGL02802:Fblim1 UTSW 4 141590120 missense possibly damaging 0.90
PIT4377001:Fblim1 UTSW 4 141595409 missense probably damaging 1.00
R0840:Fblim1 UTSW 4 141581009 missense possibly damaging 0.88
R1793:Fblim1 UTSW 4 141595238 missense probably damaging 1.00
R1975:Fblim1 UTSW 4 141584864 missense probably damaging 1.00
R4829:Fblim1 UTSW 4 141584709 missense probably damaging 1.00
R6066:Fblim1 UTSW 4 141577909 missense probably damaging 1.00
R6101:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6126:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6127:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6128:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
Z1176:Fblim1 UTSW 4 141595371 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GACTGATGGCCTTCAAGCAG -3'
(R):5'- AACACTCTTGCAAGCCAGG -3'

Sequencing Primer
(F):5'- CCACCTTGGTAATTCTGGGAAGC -3'
(R):5'- ACTCTTGCAAGCCAGGGACAG -3'
Posted On2019-10-17