Incidental Mutation 'R7525:Lrch4'
ID582912
Institutional Source Beutler Lab
Gene Symbol Lrch4
Ensembl Gene ENSMUSG00000093445
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms2810008P14Rik, LRN, LRRN4, 2900069C24Rik, SAP25
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R7525 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137629121-137641099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137639465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 582 (I582N)
Ref Sequence ENSEMBL: ENSMUSP00000031734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031734] [ENSMUST00000057314] [ENSMUST00000166099] [ENSMUST00000175968] [ENSMUST00000176667] [ENSMUST00000177466] [ENSMUST00000177477] [ENSMUST00000177545] [ENSMUST00000196511]
Predicted Effect probably damaging
Transcript: ENSMUST00000031734
AA Change: I582N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445
AA Change: I582N

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057314
SMART Domains Protein: ENSMUSP00000060844
Gene: ENSMUSG00000047182

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166099
SMART Domains Protein: ENSMUSP00000127076
Gene: ENSMUSG00000079165

DomainStartEndE-ValueType
Pfam:SAP25 76 261 1.8e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175968
AA Change: I528N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445
AA Change: I528N

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176667
AA Change: I582N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445
AA Change: I582N

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000176871
Predicted Effect probably benign
Transcript: ENSMUST00000177466
Predicted Effect probably benign
Transcript: ENSMUST00000177477
SMART Domains Protein: ENSMUSP00000135724
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177545
AA Change: I582N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720
AA Change: I582N

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196511
SMART Domains Protein: ENSMUSP00000142730
Gene: ENSMUSG00000047182

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains leucine-rich repeats (LRR) at its amino terminus and that is known to be involved in ligand binding. The carboxyl terminus may act as a membrane anchor. Identified structural elements suggest that the encoded protein resembles a receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rsf1 C CGGCGGCGGG 7: 97,579,935 probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Lrch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrch4 APN 5 137637747 missense possibly damaging 0.49
IGL01862:Lrch4 APN 5 137637009 missense probably damaging 1.00
IGL03289:Lrch4 APN 5 137633577 missense probably damaging 1.00
R0144:Lrch4 UTSW 5 137638543 critical splice donor site probably null
R0724:Lrch4 UTSW 5 137637308 missense probably damaging 1.00
R1330:Lrch4 UTSW 5 137637789 missense probably damaging 0.99
R1557:Lrch4 UTSW 5 137637556 missense probably benign 0.00
R1694:Lrch4 UTSW 5 137638461 missense probably benign 0.00
R2358:Lrch4 UTSW 5 137638548 unclassified probably benign
R3755:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R3756:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R4608:Lrch4 UTSW 5 137639146 nonsense probably null
R5056:Lrch4 UTSW 5 137636851 missense probably damaging 1.00
R5114:Lrch4 UTSW 5 137637917 missense probably benign
R5181:Lrch4 UTSW 5 137629403 missense probably damaging 1.00
R5325:Lrch4 UTSW 5 137637906 missense probably damaging 1.00
R5430:Lrch4 UTSW 5 137638533 missense possibly damaging 0.46
R5712:Lrch4 UTSW 5 137637926 missense possibly damaging 0.57
R5846:Lrch4 UTSW 5 137633657 missense probably damaging 1.00
R5909:Lrch4 UTSW 5 137633865 missense possibly damaging 0.87
R7319:Lrch4 UTSW 5 137639715 missense
R7761:Lrch4 UTSW 5 137639763 missense
RF009:Lrch4 UTSW 5 137637543 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGATATTCACGGAGGCCTGG -3'
(R):5'- CGACAGGCTTCTAGGAAACTC -3'

Sequencing Primer
(F):5'- CACAACTCCTGTTATCGAGGAGG -3'
(R):5'- GGCTTCTAGGAAACTCTCGAC -3'
Posted On2019-10-17