Mutagenetix > Incidental Mutations

Incidental Mutation 'R7525:Mgam'

582914

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R7525 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 40766020 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1791 (N1791K)

Ref Sequence

ENSEMBL: ENSMUSP00000071466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

Predicted Effect

probably benign
Transcript: ENSMUST00000071535
AA Change: N1791K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: N1791K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201148
AA Change: N1791K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: N1791K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202779
AA Change: N1164K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: N1164K

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202966

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,183,355	T998A	probably damaging	Het
AI314180	A	G	4: 58,847,038	I508T	possibly damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Akt3	T	A	1: 177,020,107	K465*	probably null	Het
Ankar	T	C	1: 72,688,641	D371G	probably benign	Het
Ankib1	T	G	5: 3,755,734	N178H	possibly damaging	Het
Arhgap10	A	G	8: 77,420,070		probably null	Het
Arhgef4	A	G	1: 34,809,704	D286G	probably damaging	Het
Bsdc1	A	T	4: 129,461,684		probably benign	Het
Camk4	T	C	18: 33,185,032	V414A	probably benign	Het
Cyp2d9	T	A	15: 82,454,092	V139E	possibly damaging	Het
Dhrs13	C	A	11: 78,032,434	N21K	unknown	Het
Dopey1	C	T	9: 86,506,290	A439V	probably damaging	Het
Dpy19l4	G	A	4: 11,317,160	Q13*	probably null	Het
Eif2ak1	T	C	5: 143,886,898	S388P	probably damaging	Het
Emilin2	T	C	17: 71,274,979	S251G	probably benign	Het
Eml4	T	A	17: 83,445,950	L350Q	probably damaging	Het
Fblim1	A	T	4: 141,590,080	L98H	probably damaging	Het
Fcrl6	T	A	1: 172,597,672	N264I	probably benign	Het
Gm13124	A	G	4: 144,565,010	F42S	probably damaging	Het
Gzme	A	C	14: 56,119,333	D57E	probably benign	Het
H2-D1	A	G	17: 35,265,933	T257A	probably damaging	Het
Hectd4	C	A	5: 121,343,665	D3092E	possibly damaging	Het
Hrc	A	G	7: 45,336,379	E318G	probably benign	Het
Hspbp1	A	G	7: 4,663,436	L315P	probably damaging	Het
Insr	A	T	8: 3,192,642	Y591N	probably damaging	Het
Lrch4	T	A	5: 137,639,465	I582N	probably damaging	Het
Lrit2	A	G	14: 37,072,493	K505E	possibly damaging	Het
Lrp1b	A	T	2: 40,657,416	N4251K		Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Mroh7	A	T	4: 106,709,702	I450N	probably benign	Het
Mylk	G	A	16: 34,988,987	M1771I	probably benign	Het
Olfr1335	A	T	4: 118,809,494	F123L	probably damaging	Het
Olfr26	A	T	9: 38,855,238	M59L	possibly damaging	Het
Olfr612	A	T	7: 103,539,131	C34*	probably null	Het
Olfr972	T	A	9: 39,874,139	L288*	probably null	Het
Parp14	A	T	16: 35,857,491	H702Q	probably benign	Het
Pcdhga1	T	C	18: 37,662,228	L95P	probably damaging	Het
Pcsk5	T	C	19: 17,642,590	T373A	probably damaging	Het
Pdzph1	A	G	17: 58,967,341	V836A	possibly damaging	Het
Pgap1	T	A	1: 54,530,922	N322I	probably benign	Het
Pikfyve	C	T	1: 65,244,426	R741*	probably null	Het
Pip4k2c	A	G	10: 127,208,904	S80P	probably damaging	Het
Plekhh3	A	G	11: 101,166,619	F271L	probably damaging	Het
Prkdc	A	T	16: 15,672,327	Y565F	probably damaging	Het
Prom2	T	C	2: 127,532,781	R612G	probably benign	Het
Psap	T	C	10: 60,299,474	V303A	probably benign	Het
Ptch1	C	T	13: 63,511,714	R1375H	probably benign	Het
Slc24a3	A	C	2: 145,613,530	K446N	probably benign	Het
Slc39a12	T	A	2: 14,494,461	M661K	probably benign	Het
Slc6a16	T	C	7: 45,259,113	L39P	probably benign	Het
Syne1	T	G	10: 5,185,559		probably null	Het
Taar8c	T	C	10: 24,101,866	N16S	probably benign	Het
Tmem98	A	G	11: 80,817,518	T105A	probably damaging	Het
Tmub1	T	A	5: 24,446,013	Y216F	probably damaging	Het
Trim16	T	G	11: 62,820,754	C84G	probably damaging	Het
Ttn	T	A	2: 76,731,229	K28978*	probably null	Het
Usp38	A	G	8: 81,014,246	V64A	probably damaging	Het
Vmn2r63	A	T	7: 42,926,982	F469Y	possibly damaging	Het
Vmn2r74	A	G	7: 85,961,302	W61R	probably benign	Het
Whamm	G	T	7: 81,593,850	G607C	probably damaging	Het
Xkr6	G	T	14: 63,819,161	V430F	probably benign	Het
Zfp398	A	G	6: 47,865,818	D268G	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTCAGGCTGTCTCATAAATGAC -3'
(R):5'- TGGAAAGTGACCAACCAGATTTTC -3'

Sequencing Primer
(F):5'- GGCAGACTACATTGCTGA -3'
(R):5'- GTGACCAACCAGATTTTCAATTCC -3'

Posted On

2019-10-17