Incidental Mutation 'R7525:Slc6a16'
ID582918
Institutional Source Beutler Lab
Gene Symbol Slc6a16
Ensembl Gene ENSMUSG00000094152
Gene Namesolute carrier family 6, member 16
SynonymsLOC381884
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7525 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45241085-45273367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45259113 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000149306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179310] [ENSMUST00000213347]
Predicted Effect probably benign
Transcript: ENSMUST00000179310
AA Change: L28P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136199
Gene: ENSMUSG00000094152
AA Change: L28P

DomainStartEndE-ValueType
Pfam:SNF 114 668 2.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179310
AA Change: L28P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000213347
AA Change: L39P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC6A16 shows structural characteristics of an Na(+)- and Cl(-)-dependent neurotransmitter transporter, including 12 transmembrane (TM) domains, intracellular N and C termini, and large extracellular loops containing multiple N-glycosylation sites.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Slc6a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0345:Slc6a16 UTSW 7 45259248 missense possibly damaging 0.50
R1721:Slc6a16 UTSW 7 45261176 missense possibly damaging 0.86
R3788:Slc6a16 UTSW 7 45259962 missense probably benign 0.01
R3854:Slc6a16 UTSW 7 45268172 missense probably damaging 1.00
R5024:Slc6a16 UTSW 7 45259966 missense probably benign 0.02
R5450:Slc6a16 UTSW 7 45261248 missense probably benign 0.33
R5624:Slc6a16 UTSW 7 45261108 missense probably benign 0.00
R5756:Slc6a16 UTSW 7 45260850 missense possibly damaging 0.95
R6224:Slc6a16 UTSW 7 45261148 missense probably damaging 1.00
R6384:Slc6a16 UTSW 7 45257593 intron probably null
R6736:Slc6a16 UTSW 7 45259028 missense possibly damaging 0.57
R7035:Slc6a16 UTSW 7 45260827 missense probably damaging 1.00
R7527:Slc6a16 UTSW 7 45272639 missense probably damaging 1.00
R7681:Slc6a16 UTSW 7 45260914 missense probably damaging 1.00
R7884:Slc6a16 UTSW 7 45259347 missense probably damaging 0.99
R7967:Slc6a16 UTSW 7 45259347 missense probably damaging 0.99
Z1177:Slc6a16 UTSW 7 45260908 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGTAGACATGGTAGCCTCC -3'
(R):5'- AATTCTGTGACACTGGGCTTGG -3'

Sequencing Primer
(F):5'- GTAGACATGGTAGCCTCCTTCAAG -3'
(R):5'- GGTTGTAAGGTAATTCTTGCCAAAGC -3'
Posted On2019-10-17