Incidental Mutation 'R7525:Or8d1'
ID 582927
Institutional Source Beutler Lab
Gene Symbol Or8d1
Ensembl Gene ENSMUSG00000047667
Gene Name olfactory receptor family 8 subfamily D member 1
Synonyms GA_x6K02T2PVTD-32550930-32551856, MOR171-9, MTPCR09, Olfr26
MMRRC Submission 045597-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7525 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38766356-38767286 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38766534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 59 (M59L)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
AlphaFold Q7TRB7
Predicted Effect possibly damaging
Transcript: ENSMUST00000104874
AA Change: M59L

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: M59L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,331,221 (GRCm39) T998A probably damaging Het
Aadacl4fm2 A G 4: 144,291,580 (GRCm39) F42S probably damaging Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Akt3 T A 1: 176,847,673 (GRCm39) K465* probably null Het
Ankar T C 1: 72,727,800 (GRCm39) D371G probably benign Het
Ankib1 T G 5: 3,805,734 (GRCm39) N178H possibly damaging Het
Arhgap10 A G 8: 78,146,699 (GRCm39) probably null Het
Arhgef4 A G 1: 34,848,785 (GRCm39) D286G probably damaging Het
Bsdc1 A T 4: 129,355,477 (GRCm39) probably benign Het
Camk4 T C 18: 33,318,085 (GRCm39) V414A probably benign Het
Cyp2d9 T A 15: 82,338,293 (GRCm39) V139E possibly damaging Het
Dhrs13 C A 11: 77,923,260 (GRCm39) N21K unknown Het
Dop1a C T 9: 86,388,343 (GRCm39) A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 (GRCm39) Q13* probably null Het
Ecpas A G 4: 58,847,038 (GRCm39) I508T possibly damaging Het
Eif2ak1 T C 5: 143,823,716 (GRCm39) S388P probably damaging Het
Emilin2 T C 17: 71,581,974 (GRCm39) S251G probably benign Het
Eml4 T A 17: 83,753,379 (GRCm39) L350Q probably damaging Het
Fblim1 A T 4: 141,317,391 (GRCm39) L98H probably damaging Het
Fcrl6 T A 1: 172,425,239 (GRCm39) N264I probably benign Het
Gzme A C 14: 56,356,790 (GRCm39) D57E probably benign Het
H2-D1 A G 17: 35,484,909 (GRCm39) T257A probably damaging Het
Hectd4 C A 5: 121,481,728 (GRCm39) D3092E possibly damaging Het
Hrc A G 7: 44,985,803 (GRCm39) E318G probably benign Het
Hspbp1 A G 7: 4,666,435 (GRCm39) L315P probably damaging Het
Insr A T 8: 3,242,642 (GRCm39) Y591N probably damaging Het
Lrch4 T A 5: 137,637,727 (GRCm39) I582N probably damaging Het
Lrit2 A G 14: 36,794,450 (GRCm39) K505E possibly damaging Het
Lrp1b A T 2: 40,547,428 (GRCm39) N4251K Het
Mfsd13a T C 19: 46,357,716 (GRCm39) F290S probably damaging Het
Mgam T G 6: 40,742,954 (GRCm39) N1791K probably benign Het
Mroh7 A T 4: 106,566,899 (GRCm39) I450N probably benign Het
Mylk G A 16: 34,809,357 (GRCm39) M1771I probably benign Het
Or10ak12 A T 4: 118,666,691 (GRCm39) F123L probably damaging Het
Or51aa2 A T 7: 103,188,338 (GRCm39) C34* probably null Het
Or8g55 T A 9: 39,785,435 (GRCm39) L288* probably null Het
Parp14 A T 16: 35,677,861 (GRCm39) H702Q probably benign Het
Pcdhga1 T C 18: 37,795,281 (GRCm39) L95P probably damaging Het
Pcsk5 T C 19: 17,619,954 (GRCm39) T373A probably damaging Het
Pdzph1 A G 17: 59,274,336 (GRCm39) V836A possibly damaging Het
Pgap1 T A 1: 54,570,081 (GRCm39) N322I probably benign Het
Pikfyve C T 1: 65,283,585 (GRCm39) R741* probably null Het
Pip4k2c A G 10: 127,044,773 (GRCm39) S80P probably damaging Het
Plekhh3 A G 11: 101,057,445 (GRCm39) F271L probably damaging Het
Prkdc A T 16: 15,490,191 (GRCm39) Y565F probably damaging Het
Prom2 T C 2: 127,374,701 (GRCm39) R612G probably benign Het
Psap T C 10: 60,135,253 (GRCm39) V303A probably benign Het
Ptch1 C T 13: 63,659,528 (GRCm39) R1375H probably benign Het
Slc24a3 A C 2: 145,455,450 (GRCm39) K446N probably benign Het
Slc39a12 T A 2: 14,499,272 (GRCm39) M661K probably benign Het
Slc6a16 T C 7: 44,908,537 (GRCm39) L39P probably benign Het
Syne1 T G 10: 5,135,559 (GRCm39) probably null Het
Taar8c T C 10: 23,977,764 (GRCm39) N16S probably benign Het
Tmem98 A G 11: 80,708,344 (GRCm39) T105A probably damaging Het
Tmub1 T A 5: 24,651,011 (GRCm39) Y216F probably damaging Het
Trim16 T G 11: 62,711,580 (GRCm39) C84G probably damaging Het
Ttn T A 2: 76,561,573 (GRCm39) K28978* probably null Het
Usp38 A G 8: 81,740,875 (GRCm39) V64A probably damaging Het
Vmn2r63 A T 7: 42,576,406 (GRCm39) F469Y possibly damaging Het
Vmn2r74 A G 7: 85,610,510 (GRCm39) W61R probably benign Het
Whamm G T 7: 81,243,598 (GRCm39) G607C probably damaging Het
Xkr6 G T 14: 64,056,610 (GRCm39) V430F probably benign Het
Zfp398 A G 6: 47,842,752 (GRCm39) D268G probably benign Het
Other mutations in Or8d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Or8d1 APN 9 38,767,095 (GRCm39) missense probably benign 0.00
IGL01909:Or8d1 APN 9 38,767,013 (GRCm39) nonsense probably null
IGL02146:Or8d1 APN 9 38,766,654 (GRCm39) missense probably benign 0.01
IGL02229:Or8d1 APN 9 38,766,712 (GRCm39) missense possibly damaging 0.62
IGL02382:Or8d1 APN 9 38,766,364 (GRCm39) missense probably benign
IGL03007:Or8d1 APN 9 38,766,592 (GRCm39) missense probably damaging 1.00
IGL03118:Or8d1 APN 9 38,766,526 (GRCm39) missense probably damaging 1.00
PIT4403001:Or8d1 UTSW 9 38,766,676 (GRCm39) missense probably benign 0.39
R0590:Or8d1 UTSW 9 38,766,766 (GRCm39) missense probably damaging 0.99
R0862:Or8d1 UTSW 9 38,766,478 (GRCm39) missense possibly damaging 0.89
R1779:Or8d1 UTSW 9 38,766,846 (GRCm39) missense possibly damaging 0.55
R1796:Or8d1 UTSW 9 38,766,820 (GRCm39) missense probably benign 0.01
R2083:Or8d1 UTSW 9 38,766,637 (GRCm39) missense probably benign 0.10
R3420:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R3421:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R4328:Or8d1 UTSW 9 38,767,132 (GRCm39) missense possibly damaging 0.62
R4470:Or8d1 UTSW 9 38,766,927 (GRCm39) missense probably damaging 1.00
R4471:Or8d1 UTSW 9 38,766,927 (GRCm39) missense probably damaging 1.00
R5047:Or8d1 UTSW 9 38,766,585 (GRCm39) missense probably benign 0.36
R5267:Or8d1 UTSW 9 38,767,101 (GRCm39) missense probably damaging 1.00
R5318:Or8d1 UTSW 9 38,766,744 (GRCm39) missense probably damaging 1.00
R6502:Or8d1 UTSW 9 38,766,933 (GRCm39) missense probably damaging 0.99
R7221:Or8d1 UTSW 9 38,766,538 (GRCm39) missense probably damaging 1.00
R7297:Or8d1 UTSW 9 38,767,245 (GRCm39) missense probably damaging 1.00
R7448:Or8d1 UTSW 9 38,766,412 (GRCm39) missense probably damaging 1.00
R8040:Or8d1 UTSW 9 38,766,460 (GRCm39) missense probably damaging 0.99
R8303:Or8d1 UTSW 9 38,766,837 (GRCm39) missense probably damaging 1.00
R8972:Or8d1 UTSW 9 38,767,254 (GRCm39) missense probably damaging 1.00
Z1177:Or8d1 UTSW 9 38,766,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAATCATTCTGCAGCAG -3'
(R):5'- AAGTCTGGAGGACATGATCAC -3'

Sequencing Primer
(F):5'- AATCATTCTGCAGCAGTTGTG -3'
(R):5'- TGGTCTACAGATGGCCACATAGC -3'
Posted On 2019-10-17