Mutagenetix > Incidental Mutations

Incidental Mutation 'R7525:Olfr972'

582928

Institutional Source

Beutler Lab

Gene Symbol

Olfr972

Ensembl Gene

ENSMUSG00000094449

Gene Name

olfactory receptor 972

Synonyms

MOR171-17, GA_x6K02T2PVTD-33572803-33573747

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7525 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39866422-39874651 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 39874139 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 288 (L288*)

Ref Sequence

ENSEMBL: ENSMUSP00000150389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079767] [ENSMUST00000215303] [ENSMUST00000216167]

Predicted Effect

probably null
Transcript: ENSMUST00000079767
AA Change: L288*

SMART Domains

Protein: ENSMUSP00000078700
Gene: ENSMUSG00000094449
AA Change: L288*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	7.1e-54	PFAM
Pfam:7tm_1	41	290	2.1e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000215303
AA Change: L288*

Predicted Effect

probably null
Transcript: ENSMUST00000216167
AA Change: L288*

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,183,355	T998A	probably damaging	Het
AI314180	A	G	4: 58,847,038	I508T	possibly damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Akt3	T	A	1: 177,020,107	K465*	probably null	Het
Ankar	T	C	1: 72,688,641	D371G	probably benign	Het
Ankib1	T	G	5: 3,755,734	N178H	possibly damaging	Het
Arhgap10	A	G	8: 77,420,070		probably null	Het
Arhgef4	A	G	1: 34,809,704	D286G	probably damaging	Het
Bsdc1	A	T	4: 129,461,684		probably benign	Het
Camk4	T	C	18: 33,185,032	V414A	probably benign	Het
Cyp2d9	T	A	15: 82,454,092	V139E	possibly damaging	Het
Dhrs13	C	A	11: 78,032,434	N21K	unknown	Het
Dopey1	C	T	9: 86,506,290	A439V	probably damaging	Het
Dpy19l4	G	A	4: 11,317,160	Q13*	probably null	Het
Eif2ak1	T	C	5: 143,886,898	S388P	probably damaging	Het
Emilin2	T	C	17: 71,274,979	S251G	probably benign	Het
Eml4	T	A	17: 83,445,950	L350Q	probably damaging	Het
Fblim1	A	T	4: 141,590,080	L98H	probably damaging	Het
Fcrl6	T	A	1: 172,597,672	N264I	probably benign	Het
Gm13124	A	G	4: 144,565,010	F42S	probably damaging	Het
Gzme	A	C	14: 56,119,333	D57E	probably benign	Het
H2-D1	A	G	17: 35,265,933	T257A	probably damaging	Het
Hectd4	C	A	5: 121,343,665	D3092E	possibly damaging	Het
Hrc	A	G	7: 45,336,379	E318G	probably benign	Het
Hspbp1	A	G	7: 4,663,436	L315P	probably damaging	Het
Insr	A	T	8: 3,192,642	Y591N	probably damaging	Het
Lrch4	T	A	5: 137,639,465	I582N	probably damaging	Het
Lrit2	A	G	14: 37,072,493	K505E	possibly damaging	Het
Lrp1b	A	T	2: 40,657,416	N4251K		Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Mgam	T	G	6: 40,766,020	N1791K	probably benign	Het
Mroh7	A	T	4: 106,709,702	I450N	probably benign	Het
Mylk	G	A	16: 34,988,987	M1771I	probably benign	Het
Olfr1335	A	T	4: 118,809,494	F123L	probably damaging	Het
Olfr26	A	T	9: 38,855,238	M59L	possibly damaging	Het
Olfr612	A	T	7: 103,539,131	C34*	probably null	Het
Parp14	A	T	16: 35,857,491	H702Q	probably benign	Het
Pcdhga1	T	C	18: 37,662,228	L95P	probably damaging	Het
Pcsk5	T	C	19: 17,642,590	T373A	probably damaging	Het
Pdzph1	A	G	17: 58,967,341	V836A	possibly damaging	Het
Pgap1	T	A	1: 54,530,922	N322I	probably benign	Het
Pikfyve	C	T	1: 65,244,426	R741*	probably null	Het
Pip4k2c	A	G	10: 127,208,904	S80P	probably damaging	Het
Plekhh3	A	G	11: 101,166,619	F271L	probably damaging	Het
Prkdc	A	T	16: 15,672,327	Y565F	probably damaging	Het
Prom2	T	C	2: 127,532,781	R612G	probably benign	Het
Psap	T	C	10: 60,299,474	V303A	probably benign	Het
Ptch1	C	T	13: 63,511,714	R1375H	probably benign	Het
Slc24a3	A	C	2: 145,613,530	K446N	probably benign	Het
Slc39a12	T	A	2: 14,494,461	M661K	probably benign	Het
Slc6a16	T	C	7: 45,259,113	L39P	probably benign	Het
Syne1	T	G	10: 5,185,559		probably null	Het
Taar8c	T	C	10: 24,101,866	N16S	probably benign	Het
Tmem98	A	G	11: 80,817,518	T105A	probably damaging	Het
Tmub1	T	A	5: 24,446,013	Y216F	probably damaging	Het
Trim16	T	G	11: 62,820,754	C84G	probably damaging	Het
Ttn	T	A	2: 76,731,229	K28978*	probably null	Het
Usp38	A	G	8: 81,014,246	V64A	probably damaging	Het
Vmn2r63	A	T	7: 42,926,982	F469Y	possibly damaging	Het
Vmn2r74	A	G	7: 85,961,302	W61R	probably benign	Het
Whamm	G	T	7: 81,593,850	G607C	probably damaging	Het
Xkr6	G	T	14: 63,819,161	V430F	probably benign	Het
Zfp398	A	G	6: 47,865,818	D268G	probably benign	Het

Other mutations in Olfr972

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01805:Olfr972	APN	9	39873779	missense	probably damaging	1.00
IGL02008:Olfr972	APN	9	39873485	missense	probably damaging	1.00
IGL02556:Olfr972	APN	9	39873610	missense	possibly damaging	0.73
BB008:Olfr972	UTSW	9	39873850	missense	possibly damaging	0.86
BB018:Olfr972	UTSW	9	39873850	missense	possibly damaging	0.86
IGL02991:Olfr972	UTSW	9	39874066	missense	probably benign	0.36
R0494:Olfr972	UTSW	9	39873402	missense	probably damaging	1.00
R0725:Olfr972	UTSW	9	39873347	missense	probably damaging	0.99
R1179:Olfr972	UTSW	9	39874075	missense	possibly damaging	0.78
R1500:Olfr972	UTSW	9	39873411	missense	probably benign	0.36
R1796:Olfr972	UTSW	9	39873971	missense	probably benign	0.12
R1970:Olfr972	UTSW	9	39873938	missense	probably damaging	1.00
R2018:Olfr972	UTSW	9	39874058	missense	probably benign	0.35
R4065:Olfr972	UTSW	9	39873422	missense	possibly damaging	0.86
R5254:Olfr972	UTSW	9	39873445	missense	possibly damaging	0.94
R5799:Olfr972	UTSW	9	39874096	missense	possibly damaging	0.78
R6751:Olfr972	UTSW	9	39873680	missense	probably benign	0.00
R7570:Olfr972	UTSW	9	39873455	missense	possibly damaging	0.59
R7803:Olfr972	UTSW	9	39874082	missense	probably benign	0.23
R7931:Olfr972	UTSW	9	39873850	missense	possibly damaging	0.86
R8344:Olfr972	UTSW	9	39873935	missense	probably benign	0.42
Z1177:Olfr972	UTSW	9	39873523	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- TTAAATCCACTGAAGGCAGGTCC -3'
(R):5'- GGCTAAAACTTGTCCTGCCC -3'

Sequencing Primer
(F):5'- GAAGGCAGGTCCAAAGCCTTC -3'
(R):5'- AAAACTTGTCCTGCCCTTAGAG -3'

Posted On

2019-10-17