Mutagenetix > Incidental Mutations

Incidental Mutation 'R7525:Dopey1'

582929

Institutional Source

Beutler Lab

Gene Symbol

Dopey1

Ensembl Gene

ENSMUSG00000034973

Gene Name

dopey family member 1

Synonyms

B130005I07Rik, D9Ertd809e

Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R7525 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86467154-86555923 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86506290 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 439 (A439V)

Ref Sequence

ENSEMBL: ENSMUSP00000139413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034987
AA Change: A439V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: A439V

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	300	1e-117	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185919
AA Change: A430V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: A430V

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	306	1.9e-106	PFAM
low complexity region	629	647	N/A	INTRINSIC
low complexity region	959	971	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
low complexity region	1294	1316	N/A	INTRINSIC
low complexity region	1333	1342	N/A	INTRINSIC
low complexity region	1360	1371	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000188675
AA Change: A439V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973
AA Change: A439V

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	306	3e-106	PFAM
low complexity region	622	640	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000190957
AA Change: A439V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: A439V

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	305	1.3e-108	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,183,355	T998A	probably damaging	Het
AI314180	A	G	4: 58,847,038	I508T	possibly damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Akt3	T	A	1: 177,020,107	K465*	probably null	Het
Ankar	T	C	1: 72,688,641	D371G	probably benign	Het
Ankib1	T	G	5: 3,755,734	N178H	possibly damaging	Het
Arhgap10	A	G	8: 77,420,070		probably null	Het
Arhgef4	A	G	1: 34,809,704	D286G	probably damaging	Het
Bsdc1	A	T	4: 129,461,684		probably benign	Het
Camk4	T	C	18: 33,185,032	V414A	probably benign	Het
Cyp2d9	T	A	15: 82,454,092	V139E	possibly damaging	Het
Dhrs13	C	A	11: 78,032,434	N21K	unknown	Het
Dpy19l4	G	A	4: 11,317,160	Q13*	probably null	Het
Eif2ak1	T	C	5: 143,886,898	S388P	probably damaging	Het
Emilin2	T	C	17: 71,274,979	S251G	probably benign	Het
Eml4	T	A	17: 83,445,950	L350Q	probably damaging	Het
Fblim1	A	T	4: 141,590,080	L98H	probably damaging	Het
Fcrl6	T	A	1: 172,597,672	N264I	probably benign	Het
Gm13124	A	G	4: 144,565,010	F42S	probably damaging	Het
Gzme	A	C	14: 56,119,333	D57E	probably benign	Het
H2-D1	A	G	17: 35,265,933	T257A	probably damaging	Het
Hectd4	C	A	5: 121,343,665	D3092E	possibly damaging	Het
Hrc	A	G	7: 45,336,379	E318G	probably benign	Het
Hspbp1	A	G	7: 4,663,436	L315P	probably damaging	Het
Insr	A	T	8: 3,192,642	Y591N	probably damaging	Het
Lrch4	T	A	5: 137,639,465	I582N	probably damaging	Het
Lrit2	A	G	14: 37,072,493	K505E	possibly damaging	Het
Lrp1b	A	T	2: 40,657,416	N4251K		Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Mgam	T	G	6: 40,766,020	N1791K	probably benign	Het
Mroh7	A	T	4: 106,709,702	I450N	probably benign	Het
Mylk	G	A	16: 34,988,987	M1771I	probably benign	Het
Olfr1335	A	T	4: 118,809,494	F123L	probably damaging	Het
Olfr26	A	T	9: 38,855,238	M59L	possibly damaging	Het
Olfr612	A	T	7: 103,539,131	C34*	probably null	Het
Olfr972	T	A	9: 39,874,139	L288*	probably null	Het
Parp14	A	T	16: 35,857,491	H702Q	probably benign	Het
Pcdhga1	T	C	18: 37,662,228	L95P	probably damaging	Het
Pcsk5	T	C	19: 17,642,590	T373A	probably damaging	Het
Pdzph1	A	G	17: 58,967,341	V836A	possibly damaging	Het
Pgap1	T	A	1: 54,530,922	N322I	probably benign	Het
Pikfyve	C	T	1: 65,244,426	R741*	probably null	Het
Pip4k2c	A	G	10: 127,208,904	S80P	probably damaging	Het
Plekhh3	A	G	11: 101,166,619	F271L	probably damaging	Het
Prkdc	A	T	16: 15,672,327	Y565F	probably damaging	Het
Prom2	T	C	2: 127,532,781	R612G	probably benign	Het
Psap	T	C	10: 60,299,474	V303A	probably benign	Het
Ptch1	C	T	13: 63,511,714	R1375H	probably benign	Het
Rsf1	C	CGGCGGCGGG	7: 97,579,935		probably benign	Het
Slc24a3	A	C	2: 145,613,530	K446N	probably benign	Het
Slc39a12	T	A	2: 14,494,461	M661K	probably benign	Het
Slc6a16	T	C	7: 45,259,113	L39P	probably benign	Het
Syne1	T	G	10: 5,185,559		probably null	Het
Taar8c	T	C	10: 24,101,866	N16S	probably benign	Het
Tmem98	A	G	11: 80,817,518	T105A	probably damaging	Het
Tmub1	T	A	5: 24,446,013	Y216F	probably damaging	Het
Trim16	T	G	11: 62,820,754	C84G	probably damaging	Het
Ttn	T	A	2: 76,731,229	K28978*	probably null	Het
Usp38	A	G	8: 81,014,246	V64A	probably damaging	Het
Vmn2r63	A	T	7: 42,926,982	F469Y	possibly damaging	Het
Vmn2r74	A	G	7: 85,961,302	W61R	probably benign	Het
Whamm	G	T	7: 81,593,850	G607C	probably damaging	Het
Xkr6	G	T	14: 63,819,161	V430F	probably benign	Het
Zfp398	A	G	6: 47,865,818	D268G	probably benign	Het

Other mutations in Dopey1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Dopey1	APN	9	86551679	missense	possibly damaging	0.57
IGL00427:Dopey1	APN	9	86521500	missense	probably benign	0.09
IGL00427:Dopey1	APN	9	86521498	missense	possibly damaging	0.93
IGL00427:Dopey1	APN	9	86521499	missense	probably damaging	0.96
IGL00577:Dopey1	APN	9	86520946	missense	probably damaging	1.00
IGL00741:Dopey1	APN	9	86522806	missense	possibly damaging	0.50
IGL00959:Dopey1	APN	9	86487431	missense	probably damaging	1.00
IGL01339:Dopey1	APN	9	86551677	missense	possibly damaging	0.90
IGL01608:Dopey1	APN	9	86507561	missense	probably benign	0.23
IGL01760:Dopey1	APN	9	86519923	missense	probably benign
IGL01788:Dopey1	APN	9	86531719	missense	probably benign	0.03
IGL01844:Dopey1	APN	9	86514085	missense	probably damaging	1.00
IGL01923:Dopey1	APN	9	86522867	missense	probably damaging	1.00
IGL02036:Dopey1	APN	9	86531765	missense	probably benign	0.18
IGL02308:Dopey1	APN	9	86520088	missense	probably damaging	0.98
IGL02494:Dopey1	APN	9	86526818	missense	probably damaging	1.00
IGL02698:Dopey1	APN	9	86524359	splice site	probably benign
IGL02731:Dopey1	APN	9	86487381	missense	probably damaging	1.00
IGL02821:Dopey1	APN	9	86520156	missense	probably benign
IGL02952:Dopey1	APN	9	86532922	splice site	probably benign
IGL03071:Dopey1	APN	9	86489615	missense	possibly damaging	0.91
IGL03271:Dopey1	APN	9	86504222	nonsense	probably null
IGL03344:Dopey1	APN	9	86536144	missense	probably damaging	1.00
Beg	UTSW	9	86548172	nonsense	probably null
groak	UTSW	9	86521657	missense	probably damaging	1.00
R0055:Dopey1	UTSW	9	86512652	missense	probably benign	0.08
R0285:Dopey1	UTSW	9	86512639	missense	probably damaging	1.00
R0415:Dopey1	UTSW	9	86506502	missense	probably damaging	1.00
R0427:Dopey1	UTSW	9	86507532	missense	probably damaging	1.00
R0514:Dopey1	UTSW	9	86520734	missense	probably damaging	1.00
R0538:Dopey1	UTSW	9	86485497	missense	probably damaging	1.00
R1118:Dopey1	UTSW	9	86515406	missense	probably damaging	1.00
R1158:Dopey1	UTSW	9	86485556	missense	probably damaging	1.00
R1272:Dopey1	UTSW	9	86521424	missense	probably damaging	1.00
R1448:Dopey1	UTSW	9	86542732	splice site	probably null
R1584:Dopey1	UTSW	9	86548172	nonsense	probably null
R1601:Dopey1	UTSW	9	86536250	missense	probably damaging	0.99
R1674:Dopey1	UTSW	9	86536160	missense	probably damaging	0.98
R1706:Dopey1	UTSW	9	86554080	missense	possibly damaging	0.92
R1856:Dopey1	UTSW	9	86492004	missense	probably damaging	0.99
R1926:Dopey1	UTSW	9	86523019	missense	probably damaging	1.00
R1929:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2029:Dopey1	UTSW	9	86521365	missense	probably damaging	1.00
R2125:Dopey1	UTSW	9	86521046	missense	probably damaging	1.00
R2206:Dopey1	UTSW	9	86521599	missense	probably benign	0.00
R2271:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2312:Dopey1	UTSW	9	86521442	nonsense	probably null
R2379:Dopey1	UTSW	9	86521085	missense	probably damaging	1.00
R2507:Dopey1	UTSW	9	86513117	missense	probably damaging	1.00
R3737:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R3804:Dopey1	UTSW	9	86520995	missense	probably damaging	1.00
R3916:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R3921:Dopey1	UTSW	9	86520271	missense	probably benign	0.06
R4035:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R4392:Dopey1	UTSW	9	86503143	intron	probably benign
R4404:Dopey1	UTSW	9	86522813	nonsense	probably null
R4513:Dopey1	UTSW	9	86520559	missense	probably benign	0.39
R4624:Dopey1	UTSW	9	86521525	missense	probably damaging	1.00
R4659:Dopey1	UTSW	9	86502032	intron	probably benign
R4910:Dopey1	UTSW	9	86492061	missense	probably damaging	1.00
R4919:Dopey1	UTSW	9	86520056	missense	possibly damaging	0.47
R5061:Dopey1	UTSW	9	86503108	splice site	probably benign
R5079:Dopey1	UTSW	9	86487421	missense	probably damaging	1.00
R5118:Dopey1	UTSW	9	86506259	missense	probably damaging	1.00
R5169:Dopey1	UTSW	9	86533021	missense	probably damaging	1.00
R5176:Dopey1	UTSW	9	86521815	missense	probably damaging	1.00
R5190:Dopey1	UTSW	9	86487304	missense	probably damaging	1.00
R5256:Dopey1	UTSW	9	86515328	missense	probably damaging	1.00
R5346:Dopey1	UTSW	9	86520782	missense	probably damaging	1.00
R5484:Dopey1	UTSW	9	86545288	missense	probably damaging	1.00
R5501:Dopey1	UTSW	9	86507730	missense	probably benign	0.04
R5554:Dopey1	UTSW	9	86521657	missense	probably damaging	1.00
R5707:Dopey1	UTSW	9	86502997	missense	possibly damaging	0.95
R5826:Dopey1	UTSW	9	86507570	missense	possibly damaging	0.94
R5921:Dopey1	UTSW	9	86501922	missense	probably damaging	1.00
R5934:Dopey1	UTSW	9	86542442	nonsense	probably null
R5936:Dopey1	UTSW	9	86536512	nonsense	probably null
R6046:Dopey1	UTSW	9	86515343	missense	probably damaging	1.00
R6053:Dopey1	UTSW	9	86515294	missense	possibly damaging	0.95
R6072:Dopey1	UTSW	9	86507697	missense	probably benign	0.00
R6104:Dopey1	UTSW	9	86520807	missense	possibly damaging	0.86
R6125:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R6299:Dopey1	UTSW	9	86504212	missense	probably damaging	1.00
R6930:Dopey1	UTSW	9	86531772	critical splice donor site	probably null
R6949:Dopey1	UTSW	9	86500860	missense	probably damaging	1.00
R6979:Dopey1	UTSW	9	86521642	missense	possibly damaging	0.77
R7035:Dopey1	UTSW	9	86524302	missense	possibly damaging	0.85
R7069:Dopey1	UTSW	9	86550169	critical splice donor site	probably null
R7101:Dopey1	UTSW	9	86507669	missense	probably benign
R7202:Dopey1	UTSW	9	86504167	splice site	probably null
R7222:Dopey1	UTSW	9	86522876	critical splice donor site	probably null
R7233:Dopey1	UTSW	9	86521696	missense	probably benign	0.00
R7236:Dopey1	UTSW	9	86515378	missense	probably damaging	1.00
R7252:Dopey1	UTSW	9	86500821	missense	probably damaging	1.00
R7268:Dopey1	UTSW	9	86512777	nonsense	probably null
R7353:Dopey1	UTSW	9	86512859	missense	probably damaging	0.99
R7481:Dopey1	UTSW	9	86535932	missense	probably damaging	1.00
R7498:Dopey1	UTSW	9	86494411	missense	possibly damaging	0.95
R7507:Dopey1	UTSW	9	86535949	missense	probably benign	0.01
R7539:Dopey1	UTSW	9	86521573	missense	probably benign	0.03
R7751:Dopey1	UTSW	9	86507730	missense	probably benign	0.00
R7753:Dopey1	UTSW	9	86489702	missense	possibly damaging	0.52
RF004:Dopey1	UTSW	9	86554191	missense	probably benign
X0019:Dopey1	UTSW	9	86506227	missense	probably damaging	1.00
X0019:Dopey1	UTSW	9	86531750	missense	probably damaging	0.98
ZE80:Dopey1	UTSW	9	86500842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTACCTCCAATCAGGCAG -3'
(R):5'- AGTTGTAACTCAGACGAATCACTAC -3'

Sequencing Primer
(F):5'- TCCAATCAGGCAGTGTTCTAGCAG -3'
(R):5'- GACGAATCACTACTGTCTCCAGGTC -3'

Posted On

2019-10-17