Mutagenetix > Incidental Mutations

Incidental Mutation 'R7525:Syne1'

582930

Institutional Source

Beutler Lab

Gene Symbol

Syne1

Ensembl Gene

ENSMUSG00000096054

Gene Name

spectrin repeat containing, nuclear envelope 1

Synonyms

A330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7525 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5020917-5551482 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to G at 5185559 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149637 (fasta)

Predicted Effect

probably null
Transcript: ENSMUST00000215295

Predicted Effect

probably null
Transcript: ENSMUST00000215467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,183,355	T998A	probably damaging	Het
AI314180	A	G	4: 58,847,038	I508T	possibly damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Akt3	T	A	1: 177,020,107	K465*	probably null	Het
Ankar	T	C	1: 72,688,641	D371G	probably benign	Het
Ankib1	T	G	5: 3,755,734	N178H	possibly damaging	Het
Arhgap10	A	G	8: 77,420,070		probably null	Het
Arhgef4	A	G	1: 34,809,704	D286G	probably damaging	Het
Bsdc1	A	T	4: 129,461,684		probably benign	Het
Camk4	T	C	18: 33,185,032	V414A	probably benign	Het
Cyp2d9	T	A	15: 82,454,092	V139E	possibly damaging	Het
Dhrs13	C	A	11: 78,032,434	N21K	unknown	Het
Dopey1	C	T	9: 86,506,290	A439V	probably damaging	Het
Dpy19l4	G	A	4: 11,317,160	Q13*	probably null	Het
Eif2ak1	T	C	5: 143,886,898	S388P	probably damaging	Het
Emilin2	T	C	17: 71,274,979	S251G	probably benign	Het
Eml4	T	A	17: 83,445,950	L350Q	probably damaging	Het
Fblim1	A	T	4: 141,590,080	L98H	probably damaging	Het
Fcrl6	T	A	1: 172,597,672	N264I	probably benign	Het
Gm13124	A	G	4: 144,565,010	F42S	probably damaging	Het
Gzme	A	C	14: 56,119,333	D57E	probably benign	Het
H2-D1	A	G	17: 35,265,933	T257A	probably damaging	Het
Hectd4	C	A	5: 121,343,665	D3092E	possibly damaging	Het
Hrc	A	G	7: 45,336,379	E318G	probably benign	Het
Hspbp1	A	G	7: 4,663,436	L315P	probably damaging	Het
Insr	A	T	8: 3,192,642	Y591N	probably damaging	Het
Lrch4	T	A	5: 137,639,465	I582N	probably damaging	Het
Lrit2	A	G	14: 37,072,493	K505E	possibly damaging	Het
Lrp1b	A	T	2: 40,657,416	N4251K		Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Mgam	T	G	6: 40,766,020	N1791K	probably benign	Het
Mroh7	A	T	4: 106,709,702	I450N	probably benign	Het
Mylk	G	A	16: 34,988,987	M1771I	probably benign	Het
Olfr1335	A	T	4: 118,809,494	F123L	probably damaging	Het
Olfr26	A	T	9: 38,855,238	M59L	possibly damaging	Het
Olfr612	A	T	7: 103,539,131	C34*	probably null	Het
Olfr972	T	A	9: 39,874,139	L288*	probably null	Het
Parp14	A	T	16: 35,857,491	H702Q	probably benign	Het
Pcdhga1	T	C	18: 37,662,228	L95P	probably damaging	Het
Pcsk5	T	C	19: 17,642,590	T373A	probably damaging	Het
Pdzph1	A	G	17: 58,967,341	V836A	possibly damaging	Het
Pgap1	T	A	1: 54,530,922	N322I	probably benign	Het
Pikfyve	C	T	1: 65,244,426	R741*	probably null	Het
Pip4k2c	A	G	10: 127,208,904	S80P	probably damaging	Het
Plekhh3	A	G	11: 101,166,619	F271L	probably damaging	Het
Prkdc	A	T	16: 15,672,327	Y565F	probably damaging	Het
Prom2	T	C	2: 127,532,781	R612G	probably benign	Het
Psap	T	C	10: 60,299,474	V303A	probably benign	Het
Ptch1	C	T	13: 63,511,714	R1375H	probably benign	Het
Rsf1	C	CGGCGGCGGG	7: 97,579,935		probably benign	Het
Slc24a3	A	C	2: 145,613,530	K446N	probably benign	Het
Slc39a12	T	A	2: 14,494,461	M661K	probably benign	Het
Slc6a16	T	C	7: 45,259,113	L39P	probably benign	Het
Taar8c	T	C	10: 24,101,866	N16S	probably benign	Het
Tmem98	A	G	11: 80,817,518	T105A	probably damaging	Het
Tmub1	T	A	5: 24,446,013	Y216F	probably damaging	Het
Trim16	T	G	11: 62,820,754	C84G	probably damaging	Het
Ttn	T	A	2: 76,731,229	K28978*	probably null	Het
Usp38	A	G	8: 81,014,246	V64A	probably damaging	Het
Vmn2r63	A	T	7: 42,926,982	F469Y	possibly damaging	Het
Vmn2r74	A	G	7: 85,961,302	W61R	probably benign	Het
Whamm	G	T	7: 81,593,850	G607C	probably damaging	Het
Xkr6	G	T	14: 63,819,161	V430F	probably benign	Het
Zfp398	A	G	6: 47,865,818	D268G	probably benign	Het

Other mutations in Syne1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Syne1	APN	10	5342167	synonymous	probably benign
IGL00725:Syne1	APN	10	5344922	missense	possibly damaging	0.48
IGL00799:Syne1	APN	10	5347878	missense	probably benign	0.00
IGL01087:Syne1	APN	10	5425708	missense	probably damaging	1.00
IGL01123:Syne1	APN	10	5344921	nonsense	probably null
IGL01147:Syne1	APN	10	5052691	nonsense	probably null
IGL01150:Syne1	APN	10	5443154	missense	probably damaging	1.00
IGL01154:Syne1	APN	10	5360848	missense	probably damaging	1.00
IGL01727:Syne1	APN	10	5047842	missense	probably damaging	0.99
IGL01761:Syne1	APN	10	5405456	missense	probably damaging	1.00
IGL01793:Syne1	APN	10	5352191	missense	possibly damaging	0.67
IGL01961:Syne1	APN	10	5043723	missense	possibly damaging	0.94
IGL01975:Syne1	APN	10	5068908	intron	probably benign
IGL02152:Syne1	APN	10	5424382	missense	probably damaging	1.00
IGL02423:Syne1	APN	10	5368295	missense	probably benign	0.00
IGL02457:Syne1	APN	10	5342167	missense	probably damaging	1.00
IGL02543:Syne1	APN	10	5043618	missense	probably damaging	0.97
IGL02836:Syne1	APN	10	5409875	splice site	probably benign
IGL03141:Syne1	APN	10	5424261	missense	probably damaging	1.00
FR4548:Syne1	UTSW	10	5032969	missense	probably benign	0.09
IGL02799:Syne1	UTSW	10	5359059	missense	probably damaging	1.00
PIT4305001:Syne1	UTSW	10	5333023	missense	probably damaging	1.00
PIT4687001:Syne1	UTSW	10	5358390	missense	possibly damaging	0.87
R0004:Syne1	UTSW	10	5443132	splice site	probably benign
R0110:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0165:Syne1	UTSW	10	5033096	missense	probably benign	0.28
R0194:Syne1	UTSW	10	5424311	missense	probably benign
R0311:Syne1	UTSW	10	5348943	missense	possibly damaging	0.92
R0328:Syne1	UTSW	10	5348945	missense	possibly damaging	0.62
R0379:Syne1	UTSW	10	5541989	missense	probably damaging	1.00
R0387:Syne1	UTSW	10	5351029	missense	probably benign
R0452:Syne1	UTSW	10	5405435	missense	probably damaging	0.98
R0456:Syne1	UTSW	10	5342252	missense	probably benign	0.04
R0457:Syne1	UTSW	10	5022041	missense	probably damaging	1.00
R0469:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0510:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0533:Syne1	UTSW	10	5358438	missense	probably benign	0.00
R0617:Syne1	UTSW	10	5350933	missense	probably damaging	1.00
R0690:Syne1	UTSW	10	5033138	splice site	probably benign
R0964:Syne1	UTSW	10	5043652	missense	possibly damaging	0.95
R1133:Syne1	UTSW	10	5349044	missense	possibly damaging	0.77
R1327:Syne1	UTSW	10	5048925	splice site	probably benign
R1339:Syne1	UTSW	10	5367571	missense	probably damaging	1.00
R1531:Syne1	UTSW	10	5347875	nonsense	probably null
R1558:Syne1	UTSW	10	5349280	nonsense	probably null
R1633:Syne1	UTSW	10	5349388	missense	probably damaging	1.00
R1642:Syne1	UTSW	10	5348694	missense	possibly damaging	0.94
R1658:Syne1	UTSW	10	5367616	missense	probably benign	0.03
R1753:Syne1	UTSW	10	5367621	missense	probably benign	0.28
R1759:Syne1	UTSW	10	5349369	missense	probably damaging	1.00
R1792:Syne1	UTSW	10	5040975	missense	probably damaging	1.00
R2076:Syne1	UTSW	10	5040897	missense	probably damaging	0.99
R2079:Syne1	UTSW	10	5361502	missense	probably benign	0.01
R2102:Syne1	UTSW	10	5056514	missense	probably damaging	1.00
R2233:Syne1	UTSW	10	5041484	missense	probably benign	0.01
R2305:Syne1	UTSW	10	5047573	missense	probably damaging	0.97
R3435:Syne1	UTSW	10	5348565	missense	probably damaging	1.00
R3749:Syne1	UTSW	10	5052267	splice site	probably benign
R3876:Syne1	UTSW	10	5052345	missense	possibly damaging	0.57
R3895:Syne1	UTSW	10	5405456	missense	probably damaging	0.98
R3974:Syne1	UTSW	10	5043630	missense	probably benign	0.06
R4042:Syne1	UTSW	10	5041584	missense	probably benign	0.21
R4120:Syne1	UTSW	10	5409798	missense	probably damaging	1.00
R4201:Syne1	UTSW	10	5347870	missense	probably benign
R4364:Syne1	UTSW	10	5353987	missense	probably damaging	0.96
R4498:Syne1	UTSW	10	5031768	missense	probably benign	0.00
R4767:Syne1	UTSW	10	5344866	nonsense	probably null
R4804:Syne1	UTSW	10	5349310	missense	possibly damaging	0.95
R4917:Syne1	UTSW	10	5057909	missense	probably damaging	1.00
R4930:Syne1	UTSW	10	5052777	missense	probably damaging	0.99
R5081:Syne1	UTSW	10	5047767	missense	probably benign	0.04
R5089:Syne1	UTSW	10	5405444	nonsense	probably null
R5174:Syne1	UTSW	10	5041490	missense	probably damaging	0.99
R5205:Syne1	UTSW	10	5052295	missense	probably benign	0.05
R5303:Syne1	UTSW	10	5420464	missense	probably benign	0.00
R5384:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5385:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5392:Syne1	UTSW	10	5348661	missense	probably damaging	1.00
R5442:Syne1	UTSW	10	5343473	missense	probably benign	0.09
R5750:Syne1	UTSW	10	5339209	missense	probably benign	0.01
R5935:Syne1	UTSW	10	5360706	unclassified	probably null
R6015:Syne1	UTSW	10	5346819	critical splice donor site	probably null
R6023:Syne1	UTSW	10	5443223	missense	probably benign	0.09
R6049:Syne1	UTSW	10	5347926	missense	possibly damaging	0.79
R6084:Syne1	UTSW	10	5348994	missense	probably damaging	1.00
R6145:Syne1	UTSW	10	5052750	missense	probably damaging	1.00
R6164:Syne1	UTSW	10	5061429	missense	probably damaging	1.00
R6165:Syne1	UTSW	10	5425678	missense	probably damaging	1.00
R6198:Syne1	UTSW	10	5302269	missense	probably damaging	0.99
R6217:Syne1	UTSW	10	5293761	missense	probably benign	0.00
R6247:Syne1	UTSW	10	5349071	missense	probably damaging	0.98
R6271:Syne1	UTSW	10	5234652	missense	probably damaging	1.00
R6338:Syne1	UTSW	10	5255475	missense	probably benign	0.00
R6344:Syne1	UTSW	10	5022212	missense	probably benign	0.08
R6434:Syne1	UTSW	10	5318422	missense	probably benign	0.01
R6476:Syne1	UTSW	10	5154531	missense	possibly damaging	0.88
R6479:Syne1	UTSW	10	5231679	nonsense	probably null
R6479:Syne1	UTSW	10	5456826	missense	probably damaging	1.00
R6546:Syne1	UTSW	10	5218645	nonsense	probably null
R6578:Syne1	UTSW	10	5405454	nonsense	probably null
R6611:Syne1	UTSW	10	5045273	missense	probably benign	0.01
R6615:Syne1	UTSW	10	5301340	missense	probably damaging	0.98
R6632:Syne1	UTSW	10	5215667	critical splice donor site	probably null
R6662:Syne1	UTSW	10	5128416	missense	probably damaging	1.00
R6677:Syne1	UTSW	10	5040942	missense	possibly damaging	0.82
R6764:Syne1	UTSW	10	5229011	nonsense	probably null
R6765:Syne1	UTSW	10	5143285	intron	probably null
R6778:Syne1	UTSW	10	5102406	missense	probably damaging	0.97
R6851:Syne1	UTSW	10	5262703	nonsense	probably null
R6878:Syne1	UTSW	10	5420388	missense	possibly damaging	0.78
R6883:Syne1	UTSW	10	5231704	nonsense	probably null
R6910:Syne1	UTSW	10	5048887	missense	probably benign	0.01
R6916:Syne1	UTSW	10	5227912	missense	probably benign	0.00
R6925:Syne1	UTSW	10	5126682	missense	probably benign	0.00
R6943:Syne1	UTSW	10	5083940	missense	probably benign
R6947:Syne1	UTSW	10	5175789	missense	probably damaging	1.00
R6965:Syne1	UTSW	10	5229120	missense	possibly damaging	0.66
R6968:Syne1	UTSW	10	5117041	missense	probably benign	0.09
R7043:Syne1	UTSW	10	5072193	missense	possibly damaging	0.77
R7059:Syne1	UTSW	10	5346859	missense	probably damaging	1.00
R7067:Syne1	UTSW	10	5234586	missense	probably damaging	1.00
R7087:Syne1	UTSW	10	5542024	start gained	probably benign
R7099:Syne1	UTSW	10	5123744	missense	probably benign	0.43
R7107:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7120:Syne1	UTSW	10	5293971	missense	probably benign
R7127:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7128:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7131:Syne1	UTSW	10	5228221	missense	probably damaging	1.00
R7132:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7133:Syne1	UTSW	10	5231592	missense	probably damaging	1.00
R7135:Syne1	UTSW	10	5233409	missense	probably benign	0.01
R7147:Syne1	UTSW	10	5249340	missense	probably damaging	1.00
R7158:Syne1	UTSW	10	5057931	missense	probably damaging	1.00
R7189:Syne1	UTSW	10	5424295	missense	probably benign	0.03
R7193:Syne1	UTSW	10	5233406	missense	probably damaging	1.00
R7194:Syne1	UTSW	10	5110859	missense	probably damaging	1.00
R7233:Syne1	UTSW	10	5302160	missense	probably damaging	1.00
R7255:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7267:Syne1	UTSW	10	5228218	missense	probably damaging	1.00
R7294:Syne1	UTSW	10	5097483	critical splice donor site	probably null
R7303:Syne1	UTSW	10	5256805	missense	probably benign	0.04
R7313:Syne1	UTSW	10	5047635	missense	probably damaging	1.00
R7330:Syne1	UTSW	10	5128434	missense	probably benign	0.00
R7334:Syne1	UTSW	10	5057886	missense	probably damaging	1.00
R7363:Syne1	UTSW	10	5140970	missense	possibly damaging	0.45
R7400:Syne1	UTSW	10	5218580	missense	probably benign	0.12
R7425:Syne1	UTSW	10	5425760	missense	probably damaging	1.00
R7427:Syne1	UTSW	10	5273718	missense	probably damaging	0.98
R7446:Syne1	UTSW	10	5222266	missense	probably benign	0.00
R7462:Syne1	UTSW	10	5052793	missense	possibly damaging	0.87
R7502:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7529:Syne1	UTSW	10	5424382	missense	probably damaging	1.00
R7577:Syne1	UTSW	10	5124820	missense	probably damaging	1.00
R7579:Syne1	UTSW	10	5349324	missense	probably damaging	1.00
R7594:Syne1	UTSW	10	5215190	critical splice donor site	probably null
R7646:Syne1	UTSW	10	5172949	missense	probably damaging	1.00
R7651:Syne1	UTSW	10	5205074	missense	probably benign	0.38
R7651:Syne1	UTSW	10	5343416	missense	probably damaging	1.00
R7669:Syne1	UTSW	10	5061531	missense	probably damaging	1.00
R7672:Syne1	UTSW	10	5218527	missense	probably benign	0.02
R7682:Syne1	UTSW	10	5162461	missense	probably benign
R7702:Syne1	UTSW	10	5245835	missense	probably damaging	1.00
X0017:Syne1	UTSW	10	5346917	missense	probably damaging	1.00
X0025:Syne1	UTSW	10	5358973	nonsense	probably null
X0063:Syne1	UTSW	10	5052354	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACCTGGTGCTCAGCCATC -3'
(R):5'- GGTGACTTACAACGTTCCTGGG -3'

Sequencing Primer
(F):5'- ATCTGGCTCTCTGGACTCCG -3'
(R):5'- CGTGGTAAGTCTTTAAAGCGTTGAAC -3'

Posted On

2019-10-17