Incidental Mutation 'R7525:Psap'
ID582932
Institutional Source Beutler Lab
Gene Symbol Psap
Ensembl Gene ENSMUSG00000004207
Gene Nameprosaposin
SynonymsSGP-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7525 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location60277627-60302597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60299474 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000126407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]
Predicted Effect probably benign
Transcript: ENSMUST00000004316
AA Change: V308A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207
AA Change: V308A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 272 1.2e-16 SMART
SapB 314 389 2.07e-20 SMART
low complexity region 412 430 N/A INTRINSIC
SapB 439 514 3.84e-24 SMART
SAPA 523 556 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073242
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105462
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105464
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105465
AA Change: V306A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207
AA Change: V306A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 270 2.76e-16 SMART
SapB 312 387 2.07e-20 SMART
low complexity region 410 428 N/A INTRINSIC
SapB 437 512 3.84e-24 SMART
SAPA 521 554 3.19e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156501
Predicted Effect probably benign
Transcript: ENSMUST00000165878
AA Change: V303A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207
AA Change: V303A

DomainStartEndE-ValueType
SAPA 18 51 1.4e-18 SMART
SapB 58 135 1.87e-27 SMART
SapB 192 267 2.76e-16 SMART
SapB 309 384 2.07e-20 SMART
low complexity region 407 425 N/A INTRINSIC
SapB 434 509 3.84e-24 SMART
SAPA 518 551 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177779
AA Change: V309A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207
AA Change: V309A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 2.37e-15 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179238
AA Change: V309A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207
AA Change: V309A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 8.5e-17 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rsf1 C CGGCGGCGGG 7: 97,579,935 probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Psap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Psap APN 10 60292536 missense probably damaging 1.00
IGL01100:Psap APN 10 60299929 missense probably benign 0.03
IGL01122:Psap APN 10 60299474 missense probably benign 0.04
IGL02544:Psap APN 10 60300626 splice site probably benign
twerk UTSW 10 60300851 missense probably damaging 1.00
R0591:Psap UTSW 10 60300855 missense possibly damaging 0.65
R0624:Psap UTSW 10 60299566 splice site probably benign
R1018:Psap UTSW 10 60300811 missense probably damaging 1.00
R1896:Psap UTSW 10 60295046 nonsense probably null
R3161:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3615:Psap UTSW 10 60294603 missense probably benign 0.06
R3616:Psap UTSW 10 60294603 missense probably benign 0.06
R4622:Psap UTSW 10 60300851 missense probably damaging 1.00
R4623:Psap UTSW 10 60300851 missense probably damaging 1.00
R4666:Psap UTSW 10 60300545 missense probably benign
R5131:Psap UTSW 10 60299957 missense possibly damaging 0.72
R5203:Psap UTSW 10 60294975 missense probably damaging 1.00
R5251:Psap UTSW 10 60301700 missense probably damaging 0.99
R5511:Psap UTSW 10 60299180 missense possibly damaging 0.51
R5764:Psap UTSW 10 60293406 missense probably benign 0.18
R6207:Psap UTSW 10 60300538 missense probably damaging 1.00
R7003:Psap UTSW 10 60299497 missense probably damaging 1.00
R7494:Psap UTSW 10 60299496 missense probably benign 0.00
R7711:Psap UTSW 10 60299855 missense probably damaging 0.96
X0019:Psap UTSW 10 60299915 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCTGCCTTCTGAATGTG -3'
(R):5'- GTCCAGAGTTGGGTGCTATAGC -3'

Sequencing Primer
(F):5'- CCTGCCTTCTGAATGTGTTTCGAG -3'
(R):5'- AGTTGGGTGCTATAGCCCTCC -3'
Posted On2019-10-17