Incidental Mutation 'R7525:Trim16'
ID582934
Institutional Source Beutler Lab
Gene Symbol Trim16
Ensembl Gene ENSMUSG00000047821
Gene Nametripartite motif-containing 16
SynonymsEBBP, 9130006M08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7525 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location62820231-62850808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62820754 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 84 (C84G)
Ref Sequence ENSEMBL: ENSMUSP00000055542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055006] [ENSMUST00000072639] [ENSMUST00000108703]
Predicted Effect probably damaging
Transcript: ENSMUST00000055006
AA Change: C84G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055542
Gene: ENSMUSG00000047821
AA Change: C84G

DomainStartEndE-ValueType
Blast:BBOX 64 113 6e-24 BLAST
BBOX 117 157 3.24e-4 SMART
coiled coil region 171 196 N/A INTRINSIC
coiled coil region 237 265 N/A INTRINSIC
PRY 364 417 1.41e-22 SMART
SPRY 418 543 6.4e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000072639
AA Change: C84G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072432
Gene: ENSMUSG00000047821
AA Change: C84G

DomainStartEndE-ValueType
Blast:BBOX 64 113 5e-24 BLAST
BBOX 117 157 3.24e-4 SMART
coiled coil region 171 196 N/A INTRINSIC
coiled coil region 237 265 N/A INTRINSIC
PRY 364 417 1.41e-22 SMART
Pfam:SPRY 418 483 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108703
SMART Domains Protein: ENSMUSP00000104343
Gene: ENSMUSG00000047821

DomainStartEndE-ValueType
Blast:BBOX 1 26 9e-10 BLAST
BBOX 30 70 3.24e-4 SMART
coiled coil region 84 109 N/A INTRINSIC
coiled coil region 150 178 N/A INTRINSIC
PRY 277 330 1.41e-22 SMART
SPRY 331 456 6.4e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tripartite motif (TRIM) family member that contains two B box domains and a coiled-coiled region that are characteristic of the B box zinc finger protein family. While it lacks a RING domain found in other TRIM proteins, the encoded protein can homodimerize or heterodimerize with other TRIM proteins and has E3 ubiquitin ligase activity. This gene is also a tumor suppressor and is involved in secretory autophagy. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rsf1 C CGGCGGCGGG 7: 97,579,935 probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Trim16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Trim16 APN 11 62837232 splice site probably benign
IGL01060:Trim16 APN 11 62820704 missense probably benign 0.06
IGL01568:Trim16 APN 11 62820858 missense probably benign 0.05
IGL01659:Trim16 APN 11 62820695 missense probably benign 0.00
IGL02519:Trim16 APN 11 62834079 missense possibly damaging 0.49
IGL02662:Trim16 APN 11 62840557 missense possibly damaging 0.91
FR4589:Trim16 UTSW 11 62820695 intron probably benign
FR4976:Trim16 UTSW 11 62820689 intron probably benign
R0007:Trim16 UTSW 11 62829118 missense probably benign 0.00
R0007:Trim16 UTSW 11 62829118 missense probably benign 0.00
R0346:Trim16 UTSW 11 62840694 missense probably benign 0.00
R0410:Trim16 UTSW 11 62820471 start gained probably benign
R1725:Trim16 UTSW 11 62820505 start codon destroyed possibly damaging 0.91
R3845:Trim16 UTSW 11 62836672 splice site probably benign
R3879:Trim16 UTSW 11 62840607 missense probably damaging 1.00
R5023:Trim16 UTSW 11 62836812 missense probably benign 0.36
R5344:Trim16 UTSW 11 62820925 missense probably damaging 1.00
R6919:Trim16 UTSW 11 62840869 missense possibly damaging 0.86
R7490:Trim16 UTSW 11 62834123 missense probably damaging 1.00
X0026:Trim16 UTSW 11 62829137 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGAATTGGATCTGATTGCCC -3'
(R):5'- CGCATTCCTGGCAGATACAC -3'

Sequencing Primer
(F):5'- ATCTGATTGCCCCGGGG -3'
(R):5'- CACTGCTGGTGCGTGTG -3'
Posted On2019-10-17