Incidental Mutation 'R7525:Ptch1'
ID582938
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7525 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63511714 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1375 (R1375H)
Ref Sequence ENSEMBL: ENSMUSP00000021921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: R1375H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: R1375H

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: R1238H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: R1238H

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Rsf1 C CGGCGGCGGG 7: 97,579,935 probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGCACACACCTCAGTTG -3'
(R):5'- GCAGAGACGCTTTTGAAATTTCTAC -3'

Sequencing Primer
(F):5'- ACACACCTCAGTTGGAGCTG -3'
(R):5'- CTACTGAAGGGCATTCTGGC -3'
Posted On2019-10-17