Incidental Mutation 'R7525:Pdzph1'
ID582947
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene NamePDZ and pleckstrin homology domains 1
Synonyms2610034M16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7525 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location58878808-58991375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58967341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 836 (V836A)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025064
AA Change: V836A

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: V836A

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 58974796 missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 58888110 missense probably benign
IGL01413:Pdzph1 APN 17 58879152 missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 58922715 missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 58967339 missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 58967511 splice site probably benign
IGL02548:Pdzph1 APN 17 58973391 missense probably benign 0.10
IGL02618:Pdzph1 APN 17 58879073 utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 58880647 missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 58932483 missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 58974069 missense probably benign
IGL03304:Pdzph1 APN 17 58880646 missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 58974234 missense probably benign 0.00
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0498:Pdzph1 UTSW 17 58973830 missense probably benign 0.00
R0553:Pdzph1 UTSW 17 58922727 missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 58954479 missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 58932432 missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 58974087 missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 58974747 missense probably benign 0.10
R1463:Pdzph1 UTSW 17 58932445 missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 58973752 missense probably benign 0.16
R1773:Pdzph1 UTSW 17 58974813 missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 58922583 missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2071:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2229:Pdzph1 UTSW 17 58932412 splice site probably benign
R2264:Pdzph1 UTSW 17 58888167 critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 58922649 missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 58973336 nonsense probably null
R4700:Pdzph1 UTSW 17 58974546 missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 58973530 missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
R5130:Pdzph1 UTSW 17 58922609 missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 58974880 missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 58973947 missense probably benign 0.00
R5770:Pdzph1 UTSW 17 58879151 missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 58885867 missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 58974412 missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 58973746 missense probably benign 0.02
R6158:Pdzph1 UTSW 17 58973627 missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 58974436 missense probably benign 0.08
R7022:Pdzph1 UTSW 17 58974126 missense probably benign 0.02
R7395:Pdzph1 UTSW 17 58879159 missense possibly damaging 0.85
R8016:Pdzph1 UTSW 17 58932481 missense not run
X0028:Pdzph1 UTSW 17 58879121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAGGTCATCTCCCAAGAAG -3'
(R):5'- CTGGTTTCATCTAGACCAGAATTTG -3'

Sequencing Primer
(F):5'- GGTCATCTCCCAAGAAGTAGTTC -3'
(R):5'- TTTGGAGATCAATAACCCCCG -3'
Posted On2019-10-17