Incidental Mutation 'R7525:Pcsk5'
ID582952
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7525 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17642590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 373 (T373A)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect probably damaging
Transcript: ENSMUST00000025618
AA Change: T373A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: T373A

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050715
AA Change: T373A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: T373A

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rsf1 C CGGCGGCGGG 7: 97,579,935 probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACGTTATCTCCTGGCC -3'
(R):5'- GTCAATTTCCAGTCAAGTTTGGTTG -3'

Sequencing Primer
(F):5'- CTGGCCTATTGTGCTAAAGACTACG -3'
(R):5'- CCAGTCAAGTTTGGTTGATACAGGC -3'
Posted On2019-10-17