Incidental Mutation 'R7525:Mfsd13a'
ID582953
Institutional Source Beutler Lab
Gene Symbol Mfsd13a
Ensembl Gene ENSMUSG00000025227
Gene Namemajor facilitator superfamily domain containing 13a
Synonyms4930538D17Rik, Tmem180, 4930449A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R7525 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46341121-46375252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46369277 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 290 (F290S)
Ref Sequence ENSEMBL: ENSMUSP00000122944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086969] [ENSMUST00000128041] [ENSMUST00000128455] [ENSMUST00000142994]
Predicted Effect probably damaging
Transcript: ENSMUST00000086969
AA Change: F290S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084189
Gene: ENSMUSG00000025227
AA Change: F290S

DomainStartEndE-ValueType
Pfam:MFS_2 15 441 6.2e-23 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128041
AA Change: F290S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119072
Gene: ENSMUSG00000025227
AA Change: F290S

DomainStartEndE-ValueType
Pfam:MFS_2 9 441 1.1e-26 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128455
Predicted Effect probably damaging
Transcript: ENSMUST00000142994
AA Change: F290S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122944
Gene: ENSMUSG00000025227
AA Change: F290S

DomainStartEndE-ValueType
Pfam:MFS_2 8 318 7.8e-17 PFAM
Meta Mutation Damage Score 0.9336 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Mfsd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Mfsd13a APN 19 46366519 missense probably damaging 1.00
IGL01380:Mfsd13a APN 19 46367908 missense probably damaging 1.00
IGL01773:Mfsd13a APN 19 46369294 missense possibly damaging 0.60
IGL02458:Mfsd13a APN 19 46372247 missense probably damaging 1.00
IGL02955:Mfsd13a APN 19 46367753 missense possibly damaging 0.81
R0057:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0113:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0114:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0115:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0361:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0656:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1174:Mfsd13a UTSW 19 46374686 missense probably benign 0.13
R1210:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1251:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R1364:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1365:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1366:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1367:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1692:Mfsd13a UTSW 19 46372076 missense probably benign 0.00
R1852:Mfsd13a UTSW 19 46372180 critical splice acceptor site probably null
R1968:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R2846:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R2985:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3415:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3416:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3431:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3432:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3735:Mfsd13a UTSW 19 46368328 missense probably damaging 1.00
R4393:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4394:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4396:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4920:Mfsd13a UTSW 19 46367216 missense probably damaging 1.00
R5289:Mfsd13a UTSW 19 46368280 missense probably benign 0.00
R5806:Mfsd13a UTSW 19 46366410 missense probably benign 0.01
R6153:Mfsd13a UTSW 19 46367882 missense probably damaging 1.00
R6514:Mfsd13a UTSW 19 46374625 unclassified probably null
R6558:Mfsd13a UTSW 19 46366478 missense probably damaging 1.00
R6649:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6649:Mfsd13a UTSW 19 46372265 missense probably benign
R6653:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6911:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
R7022:Mfsd13a UTSW 19 46368324 nonsense probably null
R7334:Mfsd13a UTSW 19 46368370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCATAGGCCACAAGGGATTG -3'
(R):5'- TGCACTTTGTCACAGTGCC -3'

Sequencing Primer
(F):5'- GCCACAAGGGATTGTCATTTAG -3'
(R):5'- TCACAGTGCCTCTGGGTGTC -3'
Posted On2019-10-17