Incidental Mutation 'R7526:Flrt3'
ID 582965
Institutional Source Beutler Lab
Gene Symbol Flrt3
Ensembl Gene ENSMUSG00000051379
Gene Name fibronectin leucine rich transmembrane protein 3
Synonyms 5530600M07Rik, C430047I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 140650914-140671469 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140660206 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 501 (T501S)
Ref Sequence ENSEMBL: ENSMUSP00000053399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056760] [ENSMUST00000078027] [ENSMUST00000110057] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
AlphaFold Q8BGT1
PDB Structure FLRT3 LRR domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056760
AA Change: T501S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053399
Gene: ENSMUSG00000051379
AA Change: T501S

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078027
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110057
AA Change: T501S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105684
Gene: ENSMUSG00000051379
AA Change: T501S

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110063
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Meta Mutation Damage Score 0.2609 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRTs may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. This gene is expressed in many tissues. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, abnormal embryonic tissue development, disrupted head formation, cardia bifida and abnormal ventral wall closure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Flrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Flrt3 APN 2 140660688 missense probably damaging 0.99
IGL02292:Flrt3 APN 2 140660125 missense probably damaging 1.00
R0030:Flrt3 UTSW 2 140660317 missense probably damaging 1.00
R1487:Flrt3 UTSW 2 140660934 missense probably damaging 1.00
R2061:Flrt3 UTSW 2 140661453 missense probably damaging 1.00
R2115:Flrt3 UTSW 2 140661503 missense probably damaging 1.00
R2326:Flrt3 UTSW 2 140661391 missense possibly damaging 0.50
R3113:Flrt3 UTSW 2 140661534 missense probably benign 0.03
R3605:Flrt3 UTSW 2 140661367 missense probably damaging 1.00
R4366:Flrt3 UTSW 2 140660407 missense probably damaging 0.99
R4702:Flrt3 UTSW 2 140661655 missense probably benign
R4799:Flrt3 UTSW 2 140660166 missense probably damaging 1.00
R5085:Flrt3 UTSW 2 140660257 missense probably damaging 0.99
R5100:Flrt3 UTSW 2 140671384 start gained probably null
R5109:Flrt3 UTSW 2 140660743 missense possibly damaging 0.51
R5635:Flrt3 UTSW 2 140660500 missense probably damaging 1.00
R5982:Flrt3 UTSW 2 140660916 missense possibly damaging 0.95
R6117:Flrt3 UTSW 2 140660445 missense possibly damaging 0.46
R6213:Flrt3 UTSW 2 140661165 missense probably damaging 1.00
R6246:Flrt3 UTSW 2 140659801 missense probably damaging 1.00
R6746:Flrt3 UTSW 2 140660025 missense probably damaging 0.99
R6854:Flrt3 UTSW 2 140660718 missense probably damaging 1.00
R7000:Flrt3 UTSW 2 140660884 nonsense probably null
R7221:Flrt3 UTSW 2 140661170 missense probably damaging 0.99
R7388:Flrt3 UTSW 2 140661752 critical splice acceptor site probably null
R7444:Flrt3 UTSW 2 140660467 missense probably benign 0.00
R7967:Flrt3 UTSW 2 140659891 nonsense probably null
R8272:Flrt3 UTSW 2 140660697 missense probably damaging 1.00
R8441:Flrt3 UTSW 2 140660626 missense probably benign 0.00
R9109:Flrt3 UTSW 2 140659959 missense probably damaging 1.00
R9257:Flrt3 UTSW 2 140660239 missense probably benign
R9298:Flrt3 UTSW 2 140659959 missense probably damaging 1.00
R9482:Flrt3 UTSW 2 140661670 missense probably benign
R9629:Flrt3 UTSW 2 140660896 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TACGCACAGTTCCGTGAAAAC -3'
(R):5'- CTATGACTGCTCTGCGACTCAG -3'

Sequencing Primer
(F):5'- GTGAAAACAGTGACCCGTTCCTATG -3'
(R):5'- ACTCAGCTGGCTTAAACTGG -3'
Posted On 2019-10-17