Incidental Mutation 'R7526:Pear1'
ID 582969
Institutional Source Beutler Lab
Gene Symbol Pear1
Ensembl Gene ENSMUSG00000028073
Gene Name platelet endothelial aggregation receptor 1
Synonyms Jedi-1, 3110045G13Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001032413.1, NM_001032414.1, NM_028460.2, NM_152799.2; MGI:1920432

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 87747890-87824306 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87752568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 704 (S704P)
Ref Sequence ENSEMBL: ENSMUSP00000133474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172621] [ENSMUST00000173468] [ENSMUST00000174219] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759]
AlphaFold Q8VIK5
Predicted Effect probably benign
Transcript: ENSMUST00000023846
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000029714
AA Change: S704P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073
AA Change: S704P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079083
AA Change: S704P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073
AA Change: S704P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090981
AA Change: S704P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073
AA Change: S704P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172621
AA Change: S704P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073
AA Change: S704P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134451
Gene: ENSMUSG00000028073
AA Change: S77P

DomainStartEndE-ValueType
EGF_like 1 34 1.85e0 SMART
EGF 33 65 3.1e-2 SMART
EGF 76 108 2.53e1 SMART
transmembrane domain 128 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173468
SMART Domains Protein: ENSMUSP00000133988
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 2.1e-16 PFAM
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF 184 215 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174219
SMART Domains Protein: ENSMUSP00000133565
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF 15 47 4.03e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174759
AA Change: S704P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073
AA Change: S704P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PEAR1 is a platelet receptor that signals upon the formation of platelet-platelet contacts independent of platelet activation and secondary to platelet aggregation (Nanda et al., 2005 [PubMed 15851471]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent defects in hemostasis or thrombus formation. Although in vitro dextran sulfate-induced platelet aggregation is impaired, platelet aggregation initiated with physiological agonists is normal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Pear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Pear1 APN 3 87752116 missense possibly damaging 0.65
IGL01810:Pear1 APN 3 87752301 missense probably damaging 0.98
IGL02269:Pear1 APN 3 87756264 missense probably damaging 1.00
IGL02635:Pear1 APN 3 87750146 makesense probably null
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0090:Pear1 UTSW 3 87754342 missense possibly damaging 0.82
R0547:Pear1 UTSW 3 87788800 splice site probably null
R1024:Pear1 UTSW 3 87760299 unclassified probably benign
R1612:Pear1 UTSW 3 87751853 critical splice donor site probably null
R1637:Pear1 UTSW 3 87756753 missense probably damaging 0.97
R1772:Pear1 UTSW 3 87754492 unclassified probably benign
R1888:Pear1 UTSW 3 87810575 splice site probably benign
R2129:Pear1 UTSW 3 87758359 nonsense probably null
R2255:Pear1 UTSW 3 87752186 missense probably damaging 1.00
R3551:Pear1 UTSW 3 87758132 missense probably benign
R3855:Pear1 UTSW 3 87751921 missense possibly damaging 0.94
R4021:Pear1 UTSW 3 87756222 missense possibly damaging 0.89
R4546:Pear1 UTSW 3 87754661 missense probably damaging 1.00
R5364:Pear1 UTSW 3 87758361 missense probably damaging 1.00
R5447:Pear1 UTSW 3 87759142 missense probably damaging 1.00
R5504:Pear1 UTSW 3 87752695 splice site probably benign
R6026:Pear1 UTSW 3 87756913 missense probably damaging 1.00
R6061:Pear1 UTSW 3 87755931 missense probably benign 0.02
R6155:Pear1 UTSW 3 87759568 missense probably damaging 0.97
R6175:Pear1 UTSW 3 87752133 missense possibly damaging 0.93
R6339:Pear1 UTSW 3 87752520 missense probably damaging 1.00
R6385:Pear1 UTSW 3 87754199 missense probably benign 0.00
R6715:Pear1 UTSW 3 87759117 missense probably damaging 1.00
R6929:Pear1 UTSW 3 87759565 nonsense probably null
R7088:Pear1 UTSW 3 87754638 missense possibly damaging 0.80
R7097:Pear1 UTSW 3 87751445 missense probably benign 0.00
R7229:Pear1 UTSW 3 87750289 missense probably benign 0.00
R7334:Pear1 UTSW 3 87750225 missense probably damaging 1.00
R7872:Pear1 UTSW 3 87752215 missense probably benign
R8925:Pear1 UTSW 3 87754583 missense probably damaging 0.99
R8927:Pear1 UTSW 3 87754583 missense probably damaging 0.99
R9014:Pear1 UTSW 3 87751172 missense probably benign
R9405:Pear1 UTSW 3 87752583 missense probably damaging 1.00
R9455:Pear1 UTSW 3 87759181 missense possibly damaging 0.96
R9593:Pear1 UTSW 3 87751173 missense probably benign 0.04
R9637:Pear1 UTSW 3 87759105 missense probably benign 0.23
X0063:Pear1 UTSW 3 87754072 missense probably damaging 1.00
Z1177:Pear1 UTSW 3 87751340 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTTCTGCCAGTGAACTTGAGTG -3'
(R):5'- AGGATGGGAGCTGTATCTGC -3'

Sequencing Primer
(F):5'- CCAGTGAACTTGAGTGCATTGTAAG -3'
(R):5'- AGCTGTATCTGCACGCCAG -3'
Posted On 2019-10-17