Incidental Mutation 'R7526:Ptprd'
ID 582973
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Name protein tyrosine phosphatase receptor type D
Synonyms 1110002J03Rik, B230219D21Rik, 3000002J10Rik
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 75859475-78130198 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75984564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 527 (E527D)
Ref Sequence ENSEMBL: ENSMUSP00000099898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000212365]
AlphaFold Q64487
Predicted Effect possibly damaging
Transcript: ENSMUST00000050757
AA Change: E764D

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: E764D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098005
AA Change: E774D

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: E774D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102834
AA Change: E527D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: E527D

DomainStartEndE-ValueType
IGc2 1 62 8.13e-4 SMART
FN3 76 155 7.92e-14 SMART
FN3 171 254 5.73e-11 SMART
IG_like 262 356 8.34e1 SMART
FN3 269 347 9.1e-14 SMART
FN3 360 437 1.21e0 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
PTPc 698 956 6.38e-134 SMART
PTPc 985 1247 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107289
AA Change: E1185D

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: E1185D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173376
AA Change: E781D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: E781D

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174023
AA Change: E771D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: E771D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174180
AA Change: E1163D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: E1163D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174531
AA Change: E768D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: E768D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174831
AA Change: E774D

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: E774D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212365
AA Change: E94D

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bicd1 T G 6: 149,415,224 (GRCm39) S646A possibly damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Ccdc9 A G 7: 16,016,325 (GRCm39) L139P probably damaging Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grik2 A T 10: 49,399,918 (GRCm39) Y271N possibly damaging Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Ing3 G A 6: 21,953,798 (GRCm39) V80I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Kif2c A T 4: 117,039,629 (GRCm39) N20K possibly damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nfatc3 T C 8: 106,805,715 (GRCm39) S195P probably damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Ubxn8 A T 8: 34,123,635 (GRCm39) N101K probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75,916,793 (GRCm39) nonsense probably null
IGL01067:Ptprd APN 4 75,977,922 (GRCm39) missense probably damaging 1.00
IGL01121:Ptprd APN 4 75,872,438 (GRCm39) splice site probably benign
IGL01531:Ptprd APN 4 76,003,757 (GRCm39) missense probably damaging 0.98
IGL01661:Ptprd APN 4 75,872,320 (GRCm39) missense probably damaging 1.00
IGL01723:Ptprd APN 4 76,161,910 (GRCm39) missense probably damaging 1.00
IGL01735:Ptprd APN 4 76,055,057 (GRCm39) splice site probably null
IGL01810:Ptprd APN 4 76,058,744 (GRCm39) splice site probably benign
IGL01834:Ptprd APN 4 76,046,832 (GRCm39) missense probably damaging 1.00
IGL01835:Ptprd APN 4 76,165,058 (GRCm39) missense probably benign 0.02
IGL01867:Ptprd APN 4 76,161,884 (GRCm39) missense probably damaging 1.00
IGL02582:Ptprd APN 4 75,865,361 (GRCm39) missense probably damaging 1.00
IGL02591:Ptprd APN 4 75,900,287 (GRCm39) missense probably damaging 1.00
IGL02741:Ptprd APN 4 76,051,521 (GRCm39) missense probably damaging 1.00
IGL02866:Ptprd APN 4 75,968,674 (GRCm39) missense probably damaging 1.00
IGL02960:Ptprd APN 4 76,047,105 (GRCm39) missense probably damaging 1.00
IGL03155:Ptprd APN 4 75,984,456 (GRCm39) missense possibly damaging 0.95
IGL03230:Ptprd APN 4 75,968,654 (GRCm39) nonsense probably null
IGL03343:Ptprd APN 4 75,977,966 (GRCm39) missense probably damaging 1.00
unhurried UTSW 4 76,018,870 (GRCm39) nonsense probably null
ANU22:Ptprd UTSW 4 76,018,693 (GRCm39) missense probably damaging 0.99
F5493:Ptprd UTSW 4 76,002,645 (GRCm39) missense probably damaging 1.00
P0033:Ptprd UTSW 4 76,047,091 (GRCm39) nonsense probably null
R0044:Ptprd UTSW 4 76,004,566 (GRCm39) missense probably benign 0.08
R0044:Ptprd UTSW 4 76,004,566 (GRCm39) missense probably benign 0.08
R0076:Ptprd UTSW 4 75,865,276 (GRCm39) splice site probably benign
R0137:Ptprd UTSW 4 76,055,140 (GRCm39) missense probably benign 0.24
R0358:Ptprd UTSW 4 75,863,226 (GRCm39) missense probably damaging 1.00
R0365:Ptprd UTSW 4 76,055,083 (GRCm39) missense probably damaging 1.00
R0385:Ptprd UTSW 4 76,046,902 (GRCm39) missense probably damaging 1.00
R0601:Ptprd UTSW 4 76,018,711 (GRCm39) missense probably benign
R0646:Ptprd UTSW 4 76,002,640 (GRCm39) missense probably damaging 0.99
R0667:Ptprd UTSW 4 75,875,583 (GRCm39) missense probably damaging 1.00
R0707:Ptprd UTSW 4 75,875,476 (GRCm39) missense probably damaging 1.00
R0734:Ptprd UTSW 4 76,058,834 (GRCm39) missense probably damaging 1.00
R0827:Ptprd UTSW 4 76,047,152 (GRCm39) missense probably damaging 0.98
R0932:Ptprd UTSW 4 76,055,122 (GRCm39) missense probably damaging 1.00
R1069:Ptprd UTSW 4 76,018,870 (GRCm39) nonsense probably null
R1069:Ptprd UTSW 4 75,916,724 (GRCm39) splice site probably benign
R1086:Ptprd UTSW 4 76,051,495 (GRCm39) missense probably damaging 1.00
R1439:Ptprd UTSW 4 75,984,437 (GRCm39) missense probably damaging 1.00
R1440:Ptprd UTSW 4 76,002,789 (GRCm39) missense probably damaging 0.98
R1688:Ptprd UTSW 4 75,900,921 (GRCm39) missense probably damaging 1.00
R1858:Ptprd UTSW 4 75,865,384 (GRCm39) missense probably damaging 1.00
R2001:Ptprd UTSW 4 75,872,359 (GRCm39) missense probably damaging 1.00
R2020:Ptprd UTSW 4 76,051,398 (GRCm39) missense probably damaging 1.00
R2023:Ptprd UTSW 4 75,875,341 (GRCm39) missense probably damaging 1.00
R2413:Ptprd UTSW 4 76,051,437 (GRCm39) missense probably damaging 1.00
R2510:Ptprd UTSW 4 76,004,248 (GRCm39) critical splice donor site probably null
R2914:Ptprd UTSW 4 75,865,338 (GRCm39) missense probably damaging 1.00
R2971:Ptprd UTSW 4 76,025,561 (GRCm39) missense probably benign 0.10
R3051:Ptprd UTSW 4 76,018,867 (GRCm39) missense probably damaging 1.00
R3433:Ptprd UTSW 4 76,004,248 (GRCm39) critical splice donor site probably null
R3964:Ptprd UTSW 4 75,978,073 (GRCm39) splice site probably benign
R4009:Ptprd UTSW 4 75,874,634 (GRCm39) missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76,046,922 (GRCm39) missense probably damaging 1.00
R4420:Ptprd UTSW 4 75,957,614 (GRCm39) missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76,021,200 (GRCm39) missense probably benign 0.22
R4575:Ptprd UTSW 4 76,162,023 (GRCm39) missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76,162,023 (GRCm39) missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76,025,570 (GRCm39) missense probably benign 0.03
R4782:Ptprd UTSW 4 76,009,769 (GRCm39) missense probably benign 0.01
R4785:Ptprd UTSW 4 76,058,790 (GRCm39) missense probably benign 0.05
R4799:Ptprd UTSW 4 76,009,769 (GRCm39) missense probably benign 0.01
R4944:Ptprd UTSW 4 76,047,136 (GRCm39) missense probably damaging 1.00
R4950:Ptprd UTSW 4 76,058,752 (GRCm39) splice site probably null
R4969:Ptprd UTSW 4 76,051,542 (GRCm39) missense probably damaging 1.00
R5153:Ptprd UTSW 4 75,930,339 (GRCm39) missense probably damaging 1.00
R5164:Ptprd UTSW 4 76,018,995 (GRCm39) splice site probably null
R5287:Ptprd UTSW 4 75,872,405 (GRCm39) nonsense probably null
R5305:Ptprd UTSW 4 75,900,863 (GRCm39) missense probably damaging 1.00
R5362:Ptprd UTSW 4 76,047,050 (GRCm39) missense probably damaging 1.00
R5403:Ptprd UTSW 4 75,872,405 (GRCm39) nonsense probably null
R5531:Ptprd UTSW 4 75,977,904 (GRCm39) critical splice donor site probably null
R5543:Ptprd UTSW 4 75,977,990 (GRCm39) missense probably damaging 1.00
R5634:Ptprd UTSW 4 75,990,255 (GRCm39) missense probably benign 0.01
R5719:Ptprd UTSW 4 75,972,839 (GRCm39) critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75,900,927 (GRCm39) missense probably damaging 1.00
R6247:Ptprd UTSW 4 75,984,528 (GRCm39) missense probably benign 0.06
R6250:Ptprd UTSW 4 76,047,232 (GRCm39) missense probably damaging 1.00
R6335:Ptprd UTSW 4 75,872,420 (GRCm39) missense probably damaging 1.00
R6352:Ptprd UTSW 4 76,009,789 (GRCm39) splice site probably null
R6533:Ptprd UTSW 4 76,046,765 (GRCm39) missense probably damaging 1.00
R6756:Ptprd UTSW 4 75,873,536 (GRCm39) missense probably damaging 1.00
R6782:Ptprd UTSW 4 76,243,377 (GRCm39) splice site probably null
R7131:Ptprd UTSW 4 75,984,577 (GRCm39) missense probably damaging 1.00
R7170:Ptprd UTSW 4 75,990,199 (GRCm39) missense probably benign 0.06
R7233:Ptprd UTSW 4 75,978,020 (GRCm39) missense probably benign 0.00
R7246:Ptprd UTSW 4 76,046,913 (GRCm39) missense probably damaging 1.00
R7413:Ptprd UTSW 4 76,165,076 (GRCm39) missense probably benign 0.00
R7428:Ptprd UTSW 4 76,004,705 (GRCm39) missense probably benign 0.03
R7442:Ptprd UTSW 4 75,978,058 (GRCm39) nonsense probably null
R7491:Ptprd UTSW 4 76,051,392 (GRCm39) missense probably benign 0.23
R7609:Ptprd UTSW 4 75,990,240 (GRCm39) missense probably benign 0.03
R7612:Ptprd UTSW 4 76,004,696 (GRCm39) missense probably benign 0.45
R7659:Ptprd UTSW 4 76,047,153 (GRCm39) missense probably benign 0.03
R7743:Ptprd UTSW 4 76,004,326 (GRCm39) missense probably damaging 1.00
R7748:Ptprd UTSW 4 76,017,741 (GRCm39) missense probably null 0.39
R7788:Ptprd UTSW 4 75,916,841 (GRCm39) missense probably damaging 1.00
R7836:Ptprd UTSW 4 75,900,881 (GRCm39) missense probably damaging 0.99
R7937:Ptprd UTSW 4 76,013,772 (GRCm39) missense probably benign 0.00
R8000:Ptprd UTSW 4 75,984,479 (GRCm39) missense possibly damaging 0.95
R8018:Ptprd UTSW 4 76,003,757 (GRCm39) missense probably damaging 0.98
R8072:Ptprd UTSW 4 76,004,273 (GRCm39) missense probably benign 0.01
R8119:Ptprd UTSW 4 76,047,263 (GRCm39) missense probably benign 0.00
R8350:Ptprd UTSW 4 75,868,898 (GRCm39) missense probably damaging 1.00
R8387:Ptprd UTSW 4 75,873,526 (GRCm39) missense probably damaging 1.00
R8458:Ptprd UTSW 4 75,984,496 (GRCm39) missense probably benign 0.00
R8529:Ptprd UTSW 4 76,047,262 (GRCm39) missense probably damaging 1.00
R8699:Ptprd UTSW 4 75,959,629 (GRCm39) missense probably benign
R8924:Ptprd UTSW 4 75,916,736 (GRCm39) critical splice donor site probably null
R8984:Ptprd UTSW 4 75,863,251 (GRCm39) missense probably damaging 1.00
R9024:Ptprd UTSW 4 75,874,567 (GRCm39) missense probably damaging 1.00
R9204:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9206:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9259:Ptprd UTSW 4 75,990,200 (GRCm39) missense probably damaging 0.99
R9311:Ptprd UTSW 4 76,051,320 (GRCm39) missense probably benign 0.25
R9417:Ptprd UTSW 4 75,865,335 (GRCm39) missense probably damaging 0.99
R9427:Ptprd UTSW 4 76,051,440 (GRCm39) missense probably benign 0.01
R9579:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9580:Ptprd UTSW 4 75,872,315 (GRCm39) missense possibly damaging 0.46
R9701:Ptprd UTSW 4 75,916,896 (GRCm39) missense probably damaging 1.00
RF016:Ptprd UTSW 4 76,046,892 (GRCm39) missense probably benign 0.01
RF023:Ptprd UTSW 4 76,046,802 (GRCm39) missense probably damaging 0.98
Z1176:Ptprd UTSW 4 76,051,451 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTATGTTGCAGGCACATCCTC -3'
(R):5'- TGCTGCAGGAAAGGTGAACC -3'

Sequencing Primer
(F):5'- TGTTGCAGGCACATCCTCAAATAAAC -3'
(R):5'- ACCAATTGTATTAGGTTCTTCCCAG -3'
Posted On 2019-10-17