Incidental Mutation 'R7526:Ptprd'
ID 582973
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Name protein tyrosine phosphatase, receptor type, D
Synonyms 1110002J03Rik, 3000002J10Rik, B230219D21Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 75941238-78211961 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76066327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 527 (E527D)
Ref Sequence ENSEMBL: ENSMUSP00000099898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000212365]
AlphaFold Q64487
Predicted Effect possibly damaging
Transcript: ENSMUST00000050757
AA Change: E764D

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: E764D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098005
AA Change: E774D

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: E774D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102834
AA Change: E527D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: E527D

DomainStartEndE-ValueType
IGc2 1 62 8.13e-4 SMART
FN3 76 155 7.92e-14 SMART
FN3 171 254 5.73e-11 SMART
IG_like 262 356 8.34e1 SMART
FN3 269 347 9.1e-14 SMART
FN3 360 437 1.21e0 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
PTPc 698 956 6.38e-134 SMART
PTPc 985 1247 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107289
AA Change: E1185D

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: E1185D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173376
AA Change: E781D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: E781D

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174023
AA Change: E771D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: E771D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174180
AA Change: E1163D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: E1163D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174531
AA Change: E768D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: E768D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174831
AA Change: E774D

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: E774D

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212365
AA Change: E94D

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75998556 nonsense probably null
IGL01067:Ptprd APN 4 76059685 missense probably damaging 1.00
IGL01121:Ptprd APN 4 75954201 splice site probably benign
IGL01531:Ptprd APN 4 76085520 missense probably damaging 0.98
IGL01661:Ptprd APN 4 75954083 missense probably damaging 1.00
IGL01723:Ptprd APN 4 76243673 missense probably damaging 1.00
IGL01735:Ptprd APN 4 76136820 splice site probably null
IGL01810:Ptprd APN 4 76140507 splice site probably benign
IGL01834:Ptprd APN 4 76128595 missense probably damaging 1.00
IGL01835:Ptprd APN 4 76246821 missense probably benign 0.02
IGL01867:Ptprd APN 4 76243647 missense probably damaging 1.00
IGL02582:Ptprd APN 4 75947124 missense probably damaging 1.00
IGL02591:Ptprd APN 4 75982050 missense probably damaging 1.00
IGL02741:Ptprd APN 4 76133284 missense probably damaging 1.00
IGL02866:Ptprd APN 4 76050437 missense probably damaging 1.00
IGL02960:Ptprd APN 4 76128868 missense probably damaging 1.00
IGL03155:Ptprd APN 4 76066219 missense possibly damaging 0.95
IGL03230:Ptprd APN 4 76050417 nonsense probably null
IGL03343:Ptprd APN 4 76059729 missense probably damaging 1.00
unhurried UTSW 4 76100633 nonsense probably null
ANU22:Ptprd UTSW 4 76100456 missense probably damaging 0.99
F5493:Ptprd UTSW 4 76084408 missense probably damaging 1.00
P0033:Ptprd UTSW 4 76128854 nonsense probably null
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0076:Ptprd UTSW 4 75947039 splice site probably benign
R0137:Ptprd UTSW 4 76136903 missense probably benign 0.24
R0358:Ptprd UTSW 4 75944989 missense probably damaging 1.00
R0365:Ptprd UTSW 4 76136846 missense probably damaging 1.00
R0385:Ptprd UTSW 4 76128665 missense probably damaging 1.00
R0601:Ptprd UTSW 4 76100474 missense probably benign
R0646:Ptprd UTSW 4 76084403 missense probably damaging 0.99
R0667:Ptprd UTSW 4 75957346 missense probably damaging 1.00
R0707:Ptprd UTSW 4 75957239 missense probably damaging 1.00
R0734:Ptprd UTSW 4 76140597 missense probably damaging 1.00
R0827:Ptprd UTSW 4 76128915 missense probably damaging 0.98
R0932:Ptprd UTSW 4 76136885 missense probably damaging 1.00
R1069:Ptprd UTSW 4 75998487 splice site probably benign
R1069:Ptprd UTSW 4 76100633 nonsense probably null
R1086:Ptprd UTSW 4 76133258 missense probably damaging 1.00
R1439:Ptprd UTSW 4 76066200 missense probably damaging 1.00
R1440:Ptprd UTSW 4 76084552 missense probably damaging 0.98
R1688:Ptprd UTSW 4 75982684 missense probably damaging 1.00
R1858:Ptprd UTSW 4 75947147 missense probably damaging 1.00
R2001:Ptprd UTSW 4 75954122 missense probably damaging 1.00
R2020:Ptprd UTSW 4 76133161 missense probably damaging 1.00
R2023:Ptprd UTSW 4 75957104 missense probably damaging 1.00
R2413:Ptprd UTSW 4 76133200 missense probably damaging 1.00
R2510:Ptprd UTSW 4 76086011 critical splice donor site probably null
R2914:Ptprd UTSW 4 75947101 missense probably damaging 1.00
R2971:Ptprd UTSW 4 76107324 missense probably benign 0.10
R3051:Ptprd UTSW 4 76100630 missense probably damaging 1.00
R3433:Ptprd UTSW 4 76086011 critical splice donor site probably null
R3964:Ptprd UTSW 4 76059836 splice site probably benign
R4009:Ptprd UTSW 4 75956397 missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76128685 missense probably damaging 1.00
R4420:Ptprd UTSW 4 76039377 missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76102963 missense probably benign 0.22
R4575:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76107333 missense probably benign 0.03
R4782:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4785:Ptprd UTSW 4 76140553 missense probably benign 0.05
R4799:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4944:Ptprd UTSW 4 76128899 missense probably damaging 1.00
R4950:Ptprd UTSW 4 76140515 splice site probably null
R4969:Ptprd UTSW 4 76133305 missense probably damaging 1.00
R5153:Ptprd UTSW 4 76012102 missense probably damaging 1.00
R5164:Ptprd UTSW 4 76100758 splice site probably null
R5287:Ptprd UTSW 4 75954168 nonsense probably null
R5305:Ptprd UTSW 4 75982626 missense probably damaging 1.00
R5362:Ptprd UTSW 4 76128813 missense probably damaging 1.00
R5403:Ptprd UTSW 4 75954168 nonsense probably null
R5531:Ptprd UTSW 4 76059667 critical splice donor site probably null
R5543:Ptprd UTSW 4 76059753 missense probably damaging 1.00
R5634:Ptprd UTSW 4 76072018 missense probably benign 0.01
R5719:Ptprd UTSW 4 76054602 critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75982690 missense probably damaging 1.00
R6247:Ptprd UTSW 4 76066291 missense probably benign 0.06
R6250:Ptprd UTSW 4 76128995 missense probably damaging 1.00
R6335:Ptprd UTSW 4 75954183 missense probably damaging 1.00
R6352:Ptprd UTSW 4 76091552 splice site probably null
R6533:Ptprd UTSW 4 76128528 missense probably damaging 1.00
R6756:Ptprd UTSW 4 75955299 missense probably damaging 1.00
R6782:Ptprd UTSW 4 76325140 splice site probably null
R7131:Ptprd UTSW 4 76066340 missense probably damaging 1.00
R7170:Ptprd UTSW 4 76071962 missense probably benign 0.06
R7233:Ptprd UTSW 4 76059783 missense probably benign 0.00
R7246:Ptprd UTSW 4 76128676 missense probably damaging 1.00
R7413:Ptprd UTSW 4 76246839 missense probably benign 0.00
R7428:Ptprd UTSW 4 76086468 missense probably benign 0.03
R7442:Ptprd UTSW 4 76059821 nonsense probably null
R7491:Ptprd UTSW 4 76133155 missense probably benign 0.23
R7609:Ptprd UTSW 4 76072003 missense probably benign 0.03
R7612:Ptprd UTSW 4 76086459 missense probably benign 0.45
R7659:Ptprd UTSW 4 76128916 missense probably benign 0.03
R7743:Ptprd UTSW 4 76086089 missense probably damaging 1.00
R7748:Ptprd UTSW 4 76099504 missense probably null 0.39
R7788:Ptprd UTSW 4 75998604 missense probably damaging 1.00
R7836:Ptprd UTSW 4 75982644 missense probably damaging 0.99
R7937:Ptprd UTSW 4 76095535 missense probably benign 0.00
R8000:Ptprd UTSW 4 76066242 missense possibly damaging 0.95
R8018:Ptprd UTSW 4 76085520 missense probably damaging 0.98
R8072:Ptprd UTSW 4 76086036 missense probably benign 0.01
R8119:Ptprd UTSW 4 76129026 missense probably benign 0.00
R8350:Ptprd UTSW 4 75950661 missense probably damaging 1.00
R8387:Ptprd UTSW 4 75955289 missense probably damaging 1.00
R8458:Ptprd UTSW 4 76066259 missense probably benign 0.00
R8529:Ptprd UTSW 4 76129025 missense probably damaging 1.00
R8699:Ptprd UTSW 4 76041392 missense probably benign
R8924:Ptprd UTSW 4 75998499 critical splice donor site probably null
R8984:Ptprd UTSW 4 75945014 missense probably damaging 1.00
R9024:Ptprd UTSW 4 75956330 missense probably damaging 1.00
R9204:Ptprd UTSW 4 75954078 missense possibly damaging 0.46
R9206:Ptprd UTSW 4 75954078 missense possibly damaging 0.46
R9259:Ptprd UTSW 4 76071963 missense probably damaging 0.99
R9311:Ptprd UTSW 4 76133083 missense probably benign 0.25
R9417:Ptprd UTSW 4 75947098 missense probably damaging 0.99
R9427:Ptprd UTSW 4 76133203 missense probably benign 0.01
R9579:Ptprd UTSW 4 75954078 missense possibly damaging 0.46
R9580:Ptprd UTSW 4 75954078 missense possibly damaging 0.46
R9701:Ptprd UTSW 4 75998659 missense probably damaging 1.00
RF016:Ptprd UTSW 4 76128655 missense probably benign 0.01
RF023:Ptprd UTSW 4 76128565 missense probably damaging 0.98
Z1176:Ptprd UTSW 4 76133214 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTATGTTGCAGGCACATCCTC -3'
(R):5'- TGCTGCAGGAAAGGTGAACC -3'

Sequencing Primer
(F):5'- TGTTGCAGGCACATCCTCAAATAAAC -3'
(R):5'- ACCAATTGTATTAGGTTCTTCCCAG -3'
Posted On 2019-10-17