Incidental Mutation 'R7526:Kif2c'
ID 582974
Institutional Source Beutler Lab
Gene Symbol Kif2c
Ensembl Gene ENSMUSG00000028678
Gene Name kinesin family member 2C
Synonyms 4930402F02Rik
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 117016830-117039821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117039629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 20 (N20K)
Ref Sequence ENSEMBL: ENSMUSP00000064261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000106436] [ENSMUST00000153953]
AlphaFold Q922S8
PDB Structure The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-ADP [X-RAY DIFFRACTION]
The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-AMPPNP [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065896
AA Change: N20K

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678
AA Change: N20K

DomainStartEndE-ValueType
low complexity region 192 205 N/A INTRINSIC
KISc 252 590 1.04e-131 SMART
coiled coil region 615 647 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106436
SMART Domains Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
KISc 201 539 1.04e-131 SMART
coiled coil region 564 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153953
Meta Mutation Damage Score 0.1560 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin-like protein that functions as a microtubule-dependent molecular motor. The encoded protein can depolymerize microtubules at the plus end, thereby promoting mitotic chromosome segregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bicd1 T G 6: 149,415,224 (GRCm39) S646A possibly damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Ccdc9 A G 7: 16,016,325 (GRCm39) L139P probably damaging Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grik2 A T 10: 49,399,918 (GRCm39) Y271N possibly damaging Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Ing3 G A 6: 21,953,798 (GRCm39) V80I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nfatc3 T C 8: 106,805,715 (GRCm39) S195P probably damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Ptprd T A 4: 75,984,564 (GRCm39) E527D probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Ubxn8 A T 8: 34,123,635 (GRCm39) N101K probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Kif2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Kif2c APN 4 117,035,443 (GRCm39) missense probably benign 0.01
IGL01020:Kif2c APN 4 117,024,101 (GRCm39) missense probably damaging 1.00
IGL01131:Kif2c APN 4 117,029,562 (GRCm39) missense probably damaging 1.00
IGL02131:Kif2c APN 4 117,035,150 (GRCm39) missense possibly damaging 0.88
IGL02455:Kif2c APN 4 117,029,551 (GRCm39) missense probably benign
IGL02556:Kif2c APN 4 117,019,802 (GRCm39) missense probably damaging 0.98
IGL03084:Kif2c APN 4 117,035,355 (GRCm39) missense possibly damaging 0.67
IGL03333:Kif2c APN 4 117,037,833 (GRCm39) missense possibly damaging 0.87
IGL03353:Kif2c APN 4 117,023,533 (GRCm39) missense probably benign 0.19
R0025:Kif2c UTSW 4 117,022,714 (GRCm39) missense probably damaging 1.00
R0466:Kif2c UTSW 4 117,029,489 (GRCm39) missense possibly damaging 0.83
R1069:Kif2c UTSW 4 117,035,350 (GRCm39) missense probably damaging 0.97
R1519:Kif2c UTSW 4 117,027,137 (GRCm39) missense probably damaging 1.00
R1594:Kif2c UTSW 4 117,035,385 (GRCm39) missense probably benign 0.02
R1789:Kif2c UTSW 4 117,024,558 (GRCm39) missense probably benign 0.18
R1894:Kif2c UTSW 4 117,019,420 (GRCm39) missense probably benign 0.02
R2340:Kif2c UTSW 4 117,027,038 (GRCm39) missense probably damaging 1.00
R2830:Kif2c UTSW 4 117,039,645 (GRCm39) splice site probably null
R3734:Kif2c UTSW 4 117,019,843 (GRCm39) missense probably benign 0.02
R4634:Kif2c UTSW 4 117,035,437 (GRCm39) missense probably benign 0.04
R4720:Kif2c UTSW 4 117,028,946 (GRCm39) missense probably benign
R4908:Kif2c UTSW 4 117,023,608 (GRCm39) missense probably damaging 1.00
R5076:Kif2c UTSW 4 117,032,066 (GRCm39) unclassified probably benign
R5855:Kif2c UTSW 4 117,039,739 (GRCm39) unclassified probably benign
R6766:Kif2c UTSW 4 117,024,280 (GRCm39) missense probably benign
R6767:Kif2c UTSW 4 117,035,385 (GRCm39) missense probably benign 0.00
R6942:Kif2c UTSW 4 117,023,575 (GRCm39) missense probably damaging 1.00
R7378:Kif2c UTSW 4 117,019,226 (GRCm39) missense possibly damaging 0.46
R7797:Kif2c UTSW 4 117,028,940 (GRCm39) missense probably benign 0.00
R8087:Kif2c UTSW 4 117,022,615 (GRCm39) missense possibly damaging 0.92
R9123:Kif2c UTSW 4 117,024,291 (GRCm39) missense probably benign 0.09
R9319:Kif2c UTSW 4 117,035,445 (GRCm39) critical splice acceptor site probably null
U24488:Kif2c UTSW 4 117,039,639 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTAGCGTTTTCCTCCTGTG -3'
(R):5'- TATCCCACATTGCTCTGCGG -3'

Sequencing Primer
(F):5'- TGTAGGGGACACCGACTG -3'
(R):5'- CGCACTGGTGACGTTGTAG -3'
Posted On 2019-10-17