Incidental Mutation 'R7526:Sema3c'
ID 582981
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms 1110036B02Rik, Semae
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 17574281-17730268 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 17727596 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 699 (H699L)
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
AlphaFold Q62181
Predicted Effect possibly damaging
Transcript: ENSMUST00000030568
AA Change: H699L

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: H699L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17694860 missense probably damaging 1.00
IGL01528:Sema3c APN 5 17714415 missense probably benign
IGL01618:Sema3c APN 5 17672506 missense probably damaging 1.00
IGL01730:Sema3c APN 5 17711436 missense probably benign 0.01
IGL01762:Sema3c APN 5 17694851 missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17721925 splice site probably benign
IGL02249:Sema3c APN 5 17662963 missense probably damaging 1.00
IGL02657:Sema3c APN 5 17576868 start codon destroyed possibly damaging 0.71
IGL02657:Sema3c APN 5 17662974 missense probably damaging 1.00
IGL03213:Sema3c APN 5 17694639 splice site probably benign
PIT4651001:Sema3c UTSW 5 17694733 missense probably benign 0.37
R0031:Sema3c UTSW 5 17694728 missense probably damaging 1.00
R0558:Sema3c UTSW 5 17714415 missense probably benign 0.00
R0964:Sema3c UTSW 5 17721909 missense probably damaging 1.00
R1164:Sema3c UTSW 5 17678314 missense probably benign 0.40
R1351:Sema3c UTSW 5 17678336 missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17678332 missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17682031 missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17727466 nonsense probably null
R1916:Sema3c UTSW 5 17727401 missense probably benign 0.06
R3934:Sema3c UTSW 5 17681940 missense probably damaging 0.97
R4284:Sema3c UTSW 5 17678347 missense probably benign 0.01
R4449:Sema3c UTSW 5 17576846 start gained probably benign
R4545:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4546:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4660:Sema3c UTSW 5 17672513 missense probably damaging 1.00
R4890:Sema3c UTSW 5 17675159 missense probably benign 0.00
R4937:Sema3c UTSW 5 17694686 missense probably benign 0.01
R5065:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17717070 critical splice donor site probably null
R5586:Sema3c UTSW 5 17711424 missense probably damaging 0.99
R5811:Sema3c UTSW 5 17675190 splice site probably null
R5886:Sema3c UTSW 5 17681986 missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17727632 missense probably benign 0.00
R6191:Sema3c UTSW 5 17653806 missense probably damaging 1.00
R6318:Sema3c UTSW 5 17672432 missense probably damaging 0.96
R6416:Sema3c UTSW 5 17576961 missense probably damaging 0.99
R6441:Sema3c UTSW 5 17724132 missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17670465 missense probably benign 0.36
R7146:Sema3c UTSW 5 17694703 missense probably benign 0.22
R7832:Sema3c UTSW 5 17694847 missense probably damaging 0.99
R8034:Sema3c UTSW 5 17727482 missense probably damaging 1.00
R8053:Sema3c UTSW 5 17655022 missense probably benign 0.00
R8076:Sema3c UTSW 5 17727364 missense probably benign 0.00
R8264:Sema3c UTSW 5 17676539 intron probably benign
R8359:Sema3c UTSW 5 17653728 missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17662938 missense probably damaging 0.99
R9174:Sema3c UTSW 5 17663041 critical splice donor site probably null
R9295:Sema3c UTSW 5 17727497 missense probably benign 0.09
R9477:Sema3c UTSW 5 17716983 missense
R9599:Sema3c UTSW 5 17714454 critical splice donor site probably null
R9702:Sema3c UTSW 5 17653830 missense probably damaging 1.00
Z1176:Sema3c UTSW 5 17727519 missense probably benign 0.04
Z1177:Sema3c UTSW 5 17717031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAGATTCTGACCAAGGACTC -3'
(R):5'- GAGCATTTGTTCCTGGAAGC -3'

Sequencing Primer
(F):5'- AGGACTCTACCACTGCATTGC -3'
(R):5'- GAGCATTTGTTCCTGGAAGCAAAAC -3'
Posted On 2019-10-17