Incidental Mutation 'R7526:Eogt'
ID 582987
Institutional Source Beutler Lab
Gene Symbol Eogt
Ensembl Gene ENSMUSG00000035245
Gene Name EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Synonyms A130022J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 97110024-97149182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97113952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 409 (F409L)
Ref Sequence ENSEMBL: ENSMUSP00000061610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054344] [ENSMUST00000113387]
AlphaFold Q8BYW9
Predicted Effect probably damaging
Transcript: ENSMUST00000054344
AA Change: F409L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061610
Gene: ENSMUSG00000035245
AA Change: F409L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF563 245 472 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113387
SMART Domains Protein: ENSMUSP00000109014
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that acts in the lumen of the endoplasmic reticulum to catalyze the transfer of N-acetylglucosamine to serine or threonine residues of extracellular-targeted proteins. This enzyme modifies proteins containing eukaryotic growth factor (EGF)-like domains, including the Notch receptor, thereby regulating developmental signalling. Mutations in this gene have been observed in individuals with Adams-Oliver syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Eogt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Eogt APN 6 97120000 missense probably damaging 0.97
IGL01292:Eogt APN 6 97144027 missense possibly damaging 0.88
IGL02332:Eogt APN 6 97125605 missense probably damaging 1.00
IGL02439:Eogt APN 6 97143973 missense possibly damaging 0.83
disappointment UTSW 6 97143965 missense probably benign 0.00
lovelorn UTSW 6 97113914 missense probably damaging 1.00
mournful UTSW 6 97118954 splice site probably null
predawn UTSW 6 97135284 splice site probably benign
Underachiever UTSW 6 97120201 missense probably benign 0.01
R0019:Eogt UTSW 6 97134273 unclassified probably benign
R0112:Eogt UTSW 6 97135284 splice site probably benign
R0325:Eogt UTSW 6 97113955 missense probably damaging 0.99
R0497:Eogt UTSW 6 97135233 missense probably benign 0.00
R0730:Eogt UTSW 6 97116009 nonsense probably null
R1730:Eogt UTSW 6 97113864 missense probably damaging 1.00
R1783:Eogt UTSW 6 97113864 missense probably damaging 1.00
R2074:Eogt UTSW 6 97131376 missense probably benign 0.02
R2279:Eogt UTSW 6 97134301 missense probably benign 0.28
R2679:Eogt UTSW 6 97120800 missense probably benign 0.01
R2993:Eogt UTSW 6 97118954 splice site probably null
R3176:Eogt UTSW 6 97131394 missense probably benign 0.21
R3276:Eogt UTSW 6 97131394 missense probably benign 0.21
R3876:Eogt UTSW 6 97120190 missense probably damaging 0.99
R3940:Eogt UTSW 6 97113914 missense probably damaging 1.00
R4613:Eogt UTSW 6 97134304 missense probably benign 0.00
R4704:Eogt UTSW 6 97113852 missense probably damaging 0.99
R4849:Eogt UTSW 6 97116055 missense probably damaging 0.99
R4867:Eogt UTSW 6 97120147 intron probably benign
R4905:Eogt UTSW 6 97142831 missense probably benign 0.01
R5120:Eogt UTSW 6 97134315 missense probably benign
R5143:Eogt UTSW 6 97125584 missense probably damaging 1.00
R5594:Eogt UTSW 6 97116035 missense probably benign 0.01
R6351:Eogt UTSW 6 97120194 missense probably damaging 1.00
R6418:Eogt UTSW 6 97145392 missense possibly damaging 0.77
R6498:Eogt UTSW 6 97135213 missense probably damaging 1.00
R6950:Eogt UTSW 6 97134382 missense possibly damaging 0.77
R7114:Eogt UTSW 6 97116004 missense probably damaging 1.00
R7185:Eogt UTSW 6 97120178 missense probably damaging 1.00
R7221:Eogt UTSW 6 97112724 missense probably damaging 1.00
R7232:Eogt UTSW 6 97119983 missense probably damaging 0.98
R7467:Eogt UTSW 6 97142833 missense probably benign 0.01
R7672:Eogt UTSW 6 97113909 missense probably damaging 1.00
R7851:Eogt UTSW 6 97120201 missense probably benign 0.01
R7956:Eogt UTSW 6 97143965 missense probably benign 0.00
R8021:Eogt UTSW 6 97134330 missense probably damaging 1.00
R8475:Eogt UTSW 6 97145366 nonsense probably null
R8508:Eogt UTSW 6 97143998 missense possibly damaging 0.67
R8550:Eogt UTSW 6 97112072 missense probably benign 0.20
R8854:Eogt UTSW 6 97131398 nonsense probably null
R9149:Eogt UTSW 6 97113878 missense probably damaging 1.00
R9258:Eogt UTSW 6 97112082 missense possibly damaging 0.86
R9500:Eogt UTSW 6 97120031 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGACCTCAGACCTTTTAGCTC -3'
(R):5'- GCTTGTTACATTATCAAGGAAGGGG -3'

Sequencing Primer
(F):5'- TTCTAATGCCCAGGCTGAAC -3'
(R):5'- TGTCTCTGTCGATCATGG -3'
Posted On 2019-10-17