Incidental Mutation 'R7526:Bicd1'
ID 582988
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene Name BICD cargo adaptor 1
Synonyms B830009D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 149408886-149563329 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 149513726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 646 (S646A)
Ref Sequence ENSEMBL: ENSMUSP00000084039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]
AlphaFold Q8BR07
Predicted Effect possibly damaging
Transcript: ENSMUST00000003544
AA Change: S646A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086829
AA Change: S646A

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111513
AA Change: S646A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172926
SMART Domains Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452

DomainStartEndE-ValueType
Pfam:BicD 1 98 1.2e-69 PFAM
low complexity region 103 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173408
AA Change: S646A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0131:Bicd1 UTSW 6 149512947 missense probably damaging 0.99
R0134:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0225:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149511962 missense probably benign 0.34
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5527:Bicd1 UTSW 6 149494636 missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
R7362:Bicd1 UTSW 6 149484093 missense probably benign 0.13
R7545:Bicd1 UTSW 6 149513492 missense probably benign
R7581:Bicd1 UTSW 6 149519004 missense probably damaging 1.00
R7589:Bicd1 UTSW 6 149513667 missense possibly damaging 0.61
R7639:Bicd1 UTSW 6 149513004 missense possibly damaging 0.92
R7715:Bicd1 UTSW 6 149512973 missense probably benign 0.11
R8188:Bicd1 UTSW 6 149550356 missense probably damaging 0.98
R8271:Bicd1 UTSW 6 149513135 missense probably benign 0.00
R8338:Bicd1 UTSW 6 149513123 missense probably benign 0.00
R8375:Bicd1 UTSW 6 149520491 missense probably benign
R8696:Bicd1 UTSW 6 149513787 missense probably damaging 1.00
R8770:Bicd1 UTSW 6 149518950 missense probably damaging 1.00
R9116:Bicd1 UTSW 6 149484176 missense probably benign 0.00
R9505:Bicd1 UTSW 6 149484024 missense probably benign 0.02
R9513:Bicd1 UTSW 6 149512893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTAGAATCAAGGACATCATC -3'
(R):5'- AGCGTATTACCTGCTTATTGGC -3'

Sequencing Primer
(F):5'- GGACATCATCTGAACCAGTTTC -3'
(R):5'- GGCTTTCAACACTGCCCTCAG -3'
Posted On 2019-10-17