Incidental Mutation 'R7526:Bicd1'
ID 582988
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene Name BICD cargo adaptor 1
Synonyms B830009D06Rik
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 149310384-149464827 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 149415224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 646 (S646A)
Ref Sequence ENSEMBL: ENSMUSP00000084039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]
AlphaFold Q8BR07
Predicted Effect possibly damaging
Transcript: ENSMUST00000003544
AA Change: S646A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086829
AA Change: S646A

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111513
AA Change: S646A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172926
SMART Domains Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452

DomainStartEndE-ValueType
Pfam:BicD 1 98 1.2e-69 PFAM
low complexity region 103 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173408
AA Change: S646A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: S646A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Ccdc9 A G 7: 16,016,325 (GRCm39) L139P probably damaging Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grik2 A T 10: 49,399,918 (GRCm39) Y271N possibly damaging Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Ing3 G A 6: 21,953,798 (GRCm39) V80I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Kif2c A T 4: 117,039,629 (GRCm39) N20K possibly damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nfatc3 T C 8: 106,805,715 (GRCm39) S195P probably damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Ptprd T A 4: 75,984,564 (GRCm39) E527D probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Ubxn8 A T 8: 34,123,635 (GRCm39) N101K probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149,451,888 (GRCm39) missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149,414,535 (GRCm39) missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149,311,054 (GRCm39) missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149,385,494 (GRCm39) missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149,415,083 (GRCm39) missense probably benign
R0123:Bicd1 UTSW 6 149,414,448 (GRCm39) missense probably benign 0.00
R0131:Bicd1 UTSW 6 149,414,445 (GRCm39) missense probably damaging 0.99
R0134:Bicd1 UTSW 6 149,414,448 (GRCm39) missense probably benign 0.00
R0225:Bicd1 UTSW 6 149,414,448 (GRCm39) missense probably benign 0.00
R0267:Bicd1 UTSW 6 149,418,540 (GRCm39) missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149,413,389 (GRCm39) missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149,413,460 (GRCm39) missense probably benign 0.34
R0729:Bicd1 UTSW 6 149,414,412 (GRCm39) missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149,414,861 (GRCm39) missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149,415,050 (GRCm39) missense probably benign 0.00
R2221:Bicd1 UTSW 6 149,418,503 (GRCm39) missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149,421,901 (GRCm39) missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149,414,400 (GRCm39) missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149,420,489 (GRCm39) missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149,420,489 (GRCm39) missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149,420,489 (GRCm39) missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149,311,051 (GRCm39) missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149,420,752 (GRCm39) intron probably benign
R4835:Bicd1 UTSW 6 149,385,588 (GRCm39) missense probably benign 0.00
R5157:Bicd1 UTSW 6 149,421,912 (GRCm39) missense probably benign 0.09
R5527:Bicd1 UTSW 6 149,396,134 (GRCm39) missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149,414,954 (GRCm39) nonsense probably null
R5643:Bicd1 UTSW 6 149,421,901 (GRCm39) missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149,421,901 (GRCm39) missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149,385,498 (GRCm39) missense probably benign 0.39
R5898:Bicd1 UTSW 6 149,415,201 (GRCm39) missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149,414,463 (GRCm39) missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149,414,674 (GRCm39) nonsense probably null
R6522:Bicd1 UTSW 6 149,385,503 (GRCm39) missense probably benign
R6781:Bicd1 UTSW 6 149,414,664 (GRCm39) missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149,311,035 (GRCm39) missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149,396,113 (GRCm39) missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149,414,403 (GRCm39) missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149,415,374 (GRCm39) missense probably damaging 1.00
R7362:Bicd1 UTSW 6 149,385,591 (GRCm39) missense probably benign 0.13
R7545:Bicd1 UTSW 6 149,414,990 (GRCm39) missense probably benign
R7581:Bicd1 UTSW 6 149,420,502 (GRCm39) missense probably damaging 1.00
R7589:Bicd1 UTSW 6 149,415,165 (GRCm39) missense possibly damaging 0.61
R7639:Bicd1 UTSW 6 149,414,502 (GRCm39) missense possibly damaging 0.92
R7715:Bicd1 UTSW 6 149,414,471 (GRCm39) missense probably benign 0.11
R8188:Bicd1 UTSW 6 149,451,854 (GRCm39) missense probably damaging 0.98
R8271:Bicd1 UTSW 6 149,414,633 (GRCm39) missense probably benign 0.00
R8338:Bicd1 UTSW 6 149,414,621 (GRCm39) missense probably benign 0.00
R8375:Bicd1 UTSW 6 149,421,989 (GRCm39) missense probably benign
R8696:Bicd1 UTSW 6 149,415,285 (GRCm39) missense probably damaging 1.00
R8770:Bicd1 UTSW 6 149,420,448 (GRCm39) missense probably damaging 1.00
R9116:Bicd1 UTSW 6 149,385,674 (GRCm39) missense probably benign 0.00
R9505:Bicd1 UTSW 6 149,385,522 (GRCm39) missense probably benign 0.02
R9513:Bicd1 UTSW 6 149,414,391 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTAGAATCAAGGACATCATC -3'
(R):5'- AGCGTATTACCTGCTTATTGGC -3'

Sequencing Primer
(F):5'- GGACATCATCTGAACCAGTTTC -3'
(R):5'- GGCTTTCAACACTGCCCTCAG -3'
Posted On 2019-10-17