Incidental Mutation 'R7526:Ccdc9'
ID 582989
Institutional Source Beutler Lab
Gene Symbol Ccdc9
Ensembl Gene ENSMUSG00000041375
Gene Name coiled-coil domain containing 9
Synonyms 2600011L02Rik
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16007967-16020720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16016325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 139 (L139P)
Ref Sequence ENSEMBL: ENSMUSP00000114088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041010] [ENSMUST00000118976] [ENSMUST00000145519] [ENSMUST00000146609] [ENSMUST00000148741] [ENSMUST00000150528] [ENSMUST00000174270]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041010
AA Change: L139P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000035597
Gene: ENSMUSG00000041375
AA Change: L139P

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 121 135 N/A INTRINSIC
coiled coil region 150 184 N/A INTRINSIC
Pfam:DUF4594 203 378 1.1e-63 PFAM
coiled coil region 425 453 N/A INTRINSIC
low complexity region 490 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118976
AA Change: L139P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114088
Gene: ENSMUSG00000041375
AA Change: L139P

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 121 135 N/A INTRINSIC
coiled coil region 150 184 N/A INTRINSIC
Pfam:DUF4594 204 375 6.3e-57 PFAM
coiled coil region 425 453 N/A INTRINSIC
low complexity region 490 507 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 580 588 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145519
Predicted Effect probably benign
Transcript: ENSMUST00000146085
SMART Domains Protein: ENSMUSP00000134049
Gene: ENSMUSG00000041375

DomainStartEndE-ValueType
Pfam:DUF4594 1 85 5.2e-16 PFAM
coiled coil region 135 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146609
Predicted Effect probably benign
Transcript: ENSMUST00000148741
Predicted Effect probably benign
Transcript: ENSMUST00000150528
Predicted Effect probably benign
Transcript: ENSMUST00000174270
SMART Domains Protein: ENSMUSP00000133798
Gene: ENSMUSG00000041375

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bicd1 T G 6: 149,415,224 (GRCm39) S646A possibly damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grik2 A T 10: 49,399,918 (GRCm39) Y271N possibly damaging Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Ing3 G A 6: 21,953,798 (GRCm39) V80I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Kif2c A T 4: 117,039,629 (GRCm39) N20K possibly damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nfatc3 T C 8: 106,805,715 (GRCm39) S195P probably damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Ptprd T A 4: 75,984,564 (GRCm39) E527D probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Ubxn8 A T 8: 34,123,635 (GRCm39) N101K probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Ccdc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Ccdc9 APN 7 16,018,424 (GRCm39) start codon destroyed probably null 0.01
IGL02167:Ccdc9 APN 7 16,018,284 (GRCm39) nonsense probably null
IGL02513:Ccdc9 APN 7 16,018,434 (GRCm39) utr 5 prime probably benign
IGL02805:Ccdc9 APN 7 16,009,199 (GRCm39) missense probably benign 0.01
R0537:Ccdc9 UTSW 7 16,014,701 (GRCm39) unclassified probably benign
R0631:Ccdc9 UTSW 7 16,012,384 (GRCm39) missense probably damaging 1.00
R1340:Ccdc9 UTSW 7 16,009,315 (GRCm39) unclassified probably benign
R1758:Ccdc9 UTSW 7 16,010,161 (GRCm39) missense probably damaging 0.99
R2067:Ccdc9 UTSW 7 16,012,475 (GRCm39) splice site probably null
R2207:Ccdc9 UTSW 7 16,018,194 (GRCm39) critical splice donor site probably benign
R5278:Ccdc9 UTSW 7 16,012,306 (GRCm39) nonsense probably null
R5371:Ccdc9 UTSW 7 16,014,655 (GRCm39) missense probably damaging 1.00
R7341:Ccdc9 UTSW 7 16,014,552 (GRCm39) missense probably damaging 1.00
R7556:Ccdc9 UTSW 7 16,018,491 (GRCm39) intron probably benign
R7683:Ccdc9 UTSW 7 16,018,287 (GRCm39) missense probably damaging 1.00
R8673:Ccdc9 UTSW 7 16,018,286 (GRCm39) missense probably damaging 1.00
R9262:Ccdc9 UTSW 7 16,012,400 (GRCm39) missense probably benign 0.01
R9322:Ccdc9 UTSW 7 16,012,360 (GRCm39) missense probably damaging 0.99
R9481:Ccdc9 UTSW 7 16,016,761 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGGCAGGCCTGTTTTC -3'
(R):5'- TTTCCCTTTCAGGAGAAGAGC -3'

Sequencing Primer
(F):5'- CTGTGCAGGAAGATGCCAAATTCC -3'
(R):5'- AGAAGAGCCTGGGTCCCTCTC -3'
Posted On 2019-10-17