Incidental Mutation 'R7526:Dmkn'
ID 582990
Institutional Source Beutler Lab
Gene Symbol Dmkn
Ensembl Gene ENSMUSG00000060962
Gene Name dermokine
Synonyms sk30, 1110014F24Rik, sk89, Dmkn, cI-36, dermokine
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30763756-30781063 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30777651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 460 (D460G)
Ref Sequence ENSEMBL: ENSMUSP00000129031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041703] [ENSMUST00000054427] [ENSMUST00000085688] [ENSMUST00000085691] [ENSMUST00000165887] [ENSMUST00000188578]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000041703
AA Change: D40G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042300
Gene: ENSMUSG00000060962
AA Change: D40G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054427
AA Change: D453G

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060362
Gene: ENSMUSG00000060962
AA Change: D453G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 5.96e-5 PROSPERO
internal_repeat_2 25 53 3.87e-5 PROSPERO
internal_repeat_2 45 73 3.87e-5 PROSPERO
internal_repeat_3 65 94 5.96e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 312 331 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
internal_repeat_1 387 414 3.28e-7 PROSPERO
internal_repeat_1 422 449 3.28e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085688
AA Change: D429G

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082831
Gene: ENSMUSG00000060962
AA Change: D429G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.61e-5 PROSPERO
internal_repeat_2 25 53 4.31e-5 PROSPERO
internal_repeat_2 45 73 4.31e-5 PROSPERO
internal_repeat_3 65 94 6.61e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 308 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
internal_repeat_1 363 390 3.84e-7 PROSPERO
internal_repeat_1 398 425 3.84e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000085691
AA Change: D444G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082834
Gene: ENSMUSG00000060962
AA Change: D444G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.12e-5 PROSPERO
internal_repeat_2 25 53 3.97e-5 PROSPERO
internal_repeat_2 45 73 3.97e-5 PROSPERO
internal_repeat_3 65 94 6.12e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 350 N/A INTRINSIC
internal_repeat_1 378 405 3.43e-7 PROSPERO
internal_repeat_1 413 440 3.43e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000165887
AA Change: D460G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129031
Gene: ENSMUSG00000060962
AA Change: D460G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_2 25 53 9.56e-5 PROSPERO
internal_repeat_2 45 73 9.56e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
internal_repeat_1 394 421 1.01e-6 PROSPERO
internal_repeat_1 429 456 1.01e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000188578
AA Change: D239G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140196
Gene: ENSMUSG00000060962
AA Change: D239G

DomainStartEndE-ValueType
low complexity region 5 102 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
internal_repeat_1 173 200 3.77e-7 PROSPERO
internal_repeat_1 208 235 3.77e-7 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Dmkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Dmkn APN 7 30778270 critical splice donor site probably null
IGL03084:Dmkn APN 7 30771056 missense possibly damaging 0.82
IGL03376:Dmkn APN 7 30771242 missense possibly damaging 0.92
R0077:Dmkn UTSW 7 30765294 missense probably benign 0.00
R0718:Dmkn UTSW 7 30764786 unclassified probably benign
R0892:Dmkn UTSW 7 30767404 missense probably damaging 1.00
R1163:Dmkn UTSW 7 30765051 missense probably damaging 1.00
R1858:Dmkn UTSW 7 30764565 missense probably benign 0.08
R2915:Dmkn UTSW 7 30765316 missense unknown
R4705:Dmkn UTSW 7 30763981 missense probably damaging 1.00
R4806:Dmkn UTSW 7 30771242 missense possibly damaging 0.92
R4921:Dmkn UTSW 7 30771233 missense probably damaging 0.99
R5031:Dmkn UTSW 7 30764236 missense probably benign 0.09
R5056:Dmkn UTSW 7 30764104 missense probably damaging 1.00
R5577:Dmkn UTSW 7 30764546 missense probably damaging 1.00
R5780:Dmkn UTSW 7 30777615 missense probably damaging 1.00
R6233:Dmkn UTSW 7 30779679 missense probably damaging 0.99
R6504:Dmkn UTSW 7 30776429 missense possibly damaging 0.82
R7383:Dmkn UTSW 7 30765368 missense unknown
R7667:Dmkn UTSW 7 30777609 missense probably damaging 1.00
R8790:Dmkn UTSW 7 30764024 missense probably benign 0.33
R9792:Dmkn UTSW 7 30765420 missense unknown
RF007:Dmkn UTSW 7 30769704 splice site probably null
RF022:Dmkn UTSW 7 30767175 small insertion probably benign
RF027:Dmkn UTSW 7 30767194 small insertion probably benign
RF030:Dmkn UTSW 7 30767182 small insertion probably benign
RF032:Dmkn UTSW 7 30767182 small insertion probably benign
RF038:Dmkn UTSW 7 30767194 small insertion probably benign
RF041:Dmkn UTSW 7 30767173 small insertion probably benign
RF054:Dmkn UTSW 7 30767188 small insertion probably benign
RF055:Dmkn UTSW 7 30767191 small insertion probably benign
RF056:Dmkn UTSW 7 30767207 small insertion probably benign
RF057:Dmkn UTSW 7 30767188 small insertion probably benign
RF062:Dmkn UTSW 7 30767175 small insertion probably benign
X0067:Dmkn UTSW 7 30778227 missense possibly damaging 0.86
Z1176:Dmkn UTSW 7 30776497 missense possibly damaging 0.82
Z1186:Dmkn UTSW 7 30765393 small deletion probably benign
Z1186:Dmkn UTSW 7 30765401 small deletion probably benign
Z1186:Dmkn UTSW 7 30767171 small insertion probably benign
Z1186:Dmkn UTSW 7 30767174 small insertion probably benign
Z1186:Dmkn UTSW 7 30767177 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCTATATCTGTCTGGGCCATTGG -3'
(R):5'- AGCTCTTGCCTTGGATGAGTC -3'

Sequencing Primer
(F):5'- TGGACTGAGCTGGGACCATTAC -3'
(R):5'- CAGCTGAAAGATCTTGTCTTGC -3'
Posted On 2019-10-17