Incidental Mutation 'R7526:Myo7a'
ID582992
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Namemyosin VIIA
SynonymsMyo7, nmf371, polka, Hdb, USH1B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7526 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location98051060-98119524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98085448 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 613 (T613K)
Ref Sequence ENSEMBL: ENSMUSP00000082046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000205746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084979
AA Change: T613K

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: T613K

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107122
AA Change: T619K

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: T619K

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107127
AA Change: T624K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: T624K

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107128
AA Change: T624K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: T624K

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205746
AA Change: T613K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 98102626 missense probably damaging 1.00
IGL00785:Myo7a APN 7 98054348 missense probably damaging 0.99
IGL00840:Myo7a APN 7 98051659 missense probably benign 0.25
IGL01362:Myo7a APN 7 98097702 missense probably damaging 1.00
IGL01484:Myo7a APN 7 98085422 missense probably damaging 1.00
IGL01673:Myo7a APN 7 98054708 missense probably benign 0.00
IGL01933:Myo7a APN 7 98083142 missense probably damaging 1.00
IGL01943:Myo7a APN 7 98065647 missense possibly damaging 0.96
IGL02188:Myo7a APN 7 98091027 missense probably damaging 0.96
IGL02304:Myo7a APN 7 98077736 missense possibly damaging 0.89
IGL02305:Myo7a APN 7 98051629 makesense probably null
IGL02331:Myo7a APN 7 98053182 missense possibly damaging 0.95
IGL02386:Myo7a APN 7 98075112 missense probably damaging 0.99
IGL02389:Myo7a APN 7 98106991 critical splice donor site probably null
IGL02832:Myo7a APN 7 98091020 critical splice donor site probably null
IGL02839:Myo7a APN 7 98091122 missense probably damaging 1.00
IGL03193:Myo7a APN 7 98091057 missense probably damaging 1.00
IGL03237:Myo7a APN 7 98102593 missense probably damaging 1.00
IGL03384:Myo7a APN 7 98093593 missense probably damaging 1.00
coward UTSW 7 98085466 missense probably damaging 1.00
H8786:Myo7a UTSW 7 98095778 missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 98079327 missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 98056767 missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 98063599 missense probably benign 0.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0267:Myo7a UTSW 7 98054624 missense probably benign 0.08
R0408:Myo7a UTSW 7 98056781 missense probably damaging 1.00
R0411:Myo7a UTSW 7 98071937 missense probably benign 0.00
R0540:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0607:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0629:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R0632:Myo7a UTSW 7 98112150 intron probably benign
R0659:Myo7a UTSW 7 98054338 splice site probably benign
R0735:Myo7a UTSW 7 98081180 splice site probably benign
R0924:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R0930:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R1018:Myo7a UTSW 7 98107005 missense probably damaging 1.00
R1196:Myo7a UTSW 7 98097673 missense possibly damaging 0.87
R1331:Myo7a UTSW 7 98107008 missense probably benign 0.00
R1487:Myo7a UTSW 7 98053810 critical splice donor site probably null
R1676:Myo7a UTSW 7 98099472 critical splice donor site probably null
R1695:Myo7a UTSW 7 98092496 missense possibly damaging 0.94
R1770:Myo7a UTSW 7 98112606 intron probably benign
R1781:Myo7a UTSW 7 98073124 missense probably damaging 1.00
R1789:Myo7a UTSW 7 98107095 missense probably damaging 0.99
R1827:Myo7a UTSW 7 98076731 missense probably damaging 0.99
R1864:Myo7a UTSW 7 98052256 missense probably damaging 1.00
R1955:Myo7a UTSW 7 98054921 missense probably damaging 1.00
R2011:Myo7a UTSW 7 98054708 missense possibly damaging 0.69
R2229:Myo7a UTSW 7 98054910 missense probably benign 0.12
R2259:Myo7a UTSW 7 98069499 missense probably damaging 1.00
R2443:Myo7a UTSW 7 98095769 missense probably benign 0.07
R2898:Myo7a UTSW 7 98054424 nonsense probably null
R2898:Myo7a UTSW 7 98097206 missense probably damaging 1.00
R3158:Myo7a UTSW 7 98052292 missense probably damaging 1.00
R3408:Myo7a UTSW 7 98081087 missense probably benign 0.00
R4222:Myo7a UTSW 7 98073229 missense possibly damaging 0.93
R4255:Myo7a UTSW 7 98071964 missense probably damaging 0.96
R4374:Myo7a UTSW 7 98102674 missense probably damaging 1.00
R4429:Myo7a UTSW 7 98053188 missense probably damaging 0.99
R4445:Myo7a UTSW 7 98066404 missense probably damaging 1.00
R4579:Myo7a UTSW 7 98073193 missense probably damaging 1.00
R4659:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R5073:Myo7a UTSW 7 98073218 nonsense probably null
R5138:Myo7a UTSW 7 98083599 missense probably damaging 1.00
R5566:Myo7a UTSW 7 98064816 missense possibly damaging 0.93
R5580:Myo7a UTSW 7 98073160 missense probably damaging 1.00
R6079:Myo7a UTSW 7 98065790 nonsense probably null
R6138:Myo7a UTSW 7 98065790 nonsense probably null
R6451:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6452:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6453:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6454:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6455:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6465:Myo7a UTSW 7 98062680 missense possibly damaging 0.95
R6653:Myo7a UTSW 7 98054503 missense probably damaging 0.96
R6709:Myo7a UTSW 7 98054699 missense probably damaging 1.00
R6917:Myo7a UTSW 7 98095763 missense possibly damaging 0.58
R7313:Myo7a UTSW 7 98064195 missense probably damaging 0.99
R7334:Myo7a UTSW 7 98079366 missense probably benign
R7356:Myo7a UTSW 7 98102683 missense probably benign 0.01
R7393:Myo7a UTSW 7 98063699 missense possibly damaging 0.91
R7472:Myo7a UTSW 7 98064793 missense probably damaging 1.00
R7483:Myo7a UTSW 7 98063674 missense probably benign 0.07
RF005:Myo7a UTSW 7 98093617 missense probably benign 0.42
U15987:Myo7a UTSW 7 98065790 nonsense probably null
X0028:Myo7a UTSW 7 98065725 missense probably damaging 1.00
X0058:Myo7a UTSW 7 98062648 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGACAAGCCCTTTAGTCTCCAG -3'
(R):5'- TGTCACAGGAGATCCCCAAC -3'

Sequencing Primer
(F):5'- CTCCAGAGAGAACAAGGCTTTCTTTC -3'
(R):5'- CCTTGACTGACCTTGGTGAC -3'
Posted On2019-10-17