Incidental Mutation 'R7526:Ubxn8'
ID 582999
Institutional Source Beutler Lab
Gene Symbol Ubxn8
Ensembl Gene ENSMUSG00000052906
Gene Name UBX domain protein 8
Synonyms D0H8S2298E, Rep-8, Rep8h, Ubxd6
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 34109614-34131995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34123635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 101 (N101K)
Ref Sequence ENSEMBL: ENSMUSP00000092992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095349]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000095349
AA Change: N101K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092992
Gene: ENSMUSG00000052906
AA Change: N101K

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:UBX 192 271 3.8e-16 PFAM
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] p97 or VCP (valosin-containing protein) is a versatile ATPase complex, and many cofactors are required for the p97 functional diversity. This gene encodes one of the p97 cofactors. This cofactor is a transmembrane protein and localized in the endoplasmic reticulum (ER) membrane. It tethers p97 to the ER membrane via its UBX domain. The association of this cofactor with p97 facilitates efficient ER-associated degradation of misfolded proteins. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bicd1 T G 6: 149,415,224 (GRCm39) S646A possibly damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Ccdc9 A G 7: 16,016,325 (GRCm39) L139P probably damaging Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grik2 A T 10: 49,399,918 (GRCm39) Y271N possibly damaging Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Ing3 G A 6: 21,953,798 (GRCm39) V80I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Kif2c A T 4: 117,039,629 (GRCm39) N20K possibly damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nfatc3 T C 8: 106,805,715 (GRCm39) S195P probably damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Ptprd T A 4: 75,984,564 (GRCm39) E527D probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Ubxn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ubxn8 APN 8 34,125,333 (GRCm39) missense probably benign 0.12
IGL01588:Ubxn8 APN 8 34,111,587 (GRCm39) missense probably damaging 1.00
IGL01769:Ubxn8 APN 8 34,119,406 (GRCm39) splice site probably benign
IGL02074:Ubxn8 APN 8 34,113,206 (GRCm39) missense possibly damaging 0.77
PIT4468001:Ubxn8 UTSW 8 34,111,569 (GRCm39) missense probably benign 0.10
R0098:Ubxn8 UTSW 8 34,125,393 (GRCm39) splice site probably benign
R0098:Ubxn8 UTSW 8 34,125,393 (GRCm39) splice site probably benign
R1167:Ubxn8 UTSW 8 34,131,929 (GRCm39) missense probably damaging 0.97
R5203:Ubxn8 UTSW 8 34,123,639 (GRCm39) missense probably damaging 0.98
R5299:Ubxn8 UTSW 8 34,131,947 (GRCm39) missense possibly damaging 0.66
R6694:Ubxn8 UTSW 8 34,111,572 (GRCm39) missense possibly damaging 0.59
R7266:Ubxn8 UTSW 8 34,113,231 (GRCm39) missense probably damaging 0.99
R7938:Ubxn8 UTSW 8 34,111,712 (GRCm39) missense probably damaging 1.00
R8018:Ubxn8 UTSW 8 34,113,243 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAAGTACACACTGGGC -3'
(R):5'- ATTTCCCAATCGTGCCAGC -3'

Sequencing Primer
(F):5'- TGTGTACACGAGCATGCTC -3'
(R):5'- AATCGTGCCAGCCCCTC -3'
Posted On 2019-10-17