Incidental Mutation 'R7526:Nfatc3'
ID 583003
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
Synonyms NFATx, D8Ertd281e, NFAT4
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 106785472-106857169 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106805715 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 195 (S195P)
Ref Sequence ENSEMBL: ENSMUSP00000104931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109308
AA Change: S195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: S195P

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211991
AA Change: S187P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212742
AA Change: S187P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2593 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bicd1 T G 6: 149,415,224 (GRCm39) S646A possibly damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Ccdc9 A G 7: 16,016,325 (GRCm39) L139P probably damaging Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grik2 A T 10: 49,399,918 (GRCm39) Y271N possibly damaging Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Ing3 G A 6: 21,953,798 (GRCm39) V80I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Kif2c A T 4: 117,039,629 (GRCm39) N20K possibly damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Ptprd T A 4: 75,984,564 (GRCm39) E527D probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Ubxn8 A T 8: 34,123,635 (GRCm39) N101K probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106,825,809 (GRCm39) missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106,854,553 (GRCm39) missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106,805,532 (GRCm39) missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106,834,817 (GRCm39) missense probably benign 0.29
Kampf UTSW 8 106,825,782 (GRCm39) missense probably benign 0.23
Struggles UTSW 8 106,810,502 (GRCm39) nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106,786,605 (GRCm39) missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106,805,835 (GRCm39) missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106,854,574 (GRCm39) missense possibly damaging 0.90
R0348:Nfatc3 UTSW 8 106,818,827 (GRCm39) missense probably damaging 1.00
R0410:Nfatc3 UTSW 8 106,822,828 (GRCm39) missense probably damaging 1.00
R1509:Nfatc3 UTSW 8 106,810,486 (GRCm39) missense possibly damaging 0.46
R1702:Nfatc3 UTSW 8 106,818,792 (GRCm39) missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106,810,466 (GRCm39) missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106,805,482 (GRCm39) missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106,825,768 (GRCm39) missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106,835,087 (GRCm39) missense probably damaging 1.00
R2878:Nfatc3 UTSW 8 106,818,776 (GRCm39) missense probably damaging 1.00
R3802:Nfatc3 UTSW 8 106,806,277 (GRCm39) missense probably damaging 0.99
R3959:Nfatc3 UTSW 8 106,825,709 (GRCm39) nonsense probably null
R4006:Nfatc3 UTSW 8 106,835,471 (GRCm39) missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106,806,123 (GRCm39) missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106,805,705 (GRCm39) missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106,835,011 (GRCm39) missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106,806,359 (GRCm39) missense probably damaging 1.00
R5042:Nfatc3 UTSW 8 106,834,757 (GRCm39) missense probably benign 0.25
R5632:Nfatc3 UTSW 8 106,805,689 (GRCm39) missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106,805,698 (GRCm39) missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106,822,944 (GRCm39) missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106,810,502 (GRCm39) nonsense probably null
R6557:Nfatc3 UTSW 8 106,845,986 (GRCm39) missense probably benign 0.01
R6737:Nfatc3 UTSW 8 106,810,601 (GRCm39) missense probably damaging 1.00
R6925:Nfatc3 UTSW 8 106,845,954 (GRCm39) missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106,835,578 (GRCm39) missense probably benign 0.00
R7429:Nfatc3 UTSW 8 106,835,035 (GRCm39) missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106,835,035 (GRCm39) missense probably benign 0.00
R7760:Nfatc3 UTSW 8 106,834,973 (GRCm39) missense possibly damaging 0.66
R8783:Nfatc3 UTSW 8 106,825,784 (GRCm39) missense possibly damaging 0.63
R8867:Nfatc3 UTSW 8 106,805,640 (GRCm39) missense probably damaging 1.00
R8978:Nfatc3 UTSW 8 106,835,402 (GRCm39) missense probably benign 0.03
R9021:Nfatc3 UTSW 8 106,818,745 (GRCm39) missense probably damaging 1.00
R9066:Nfatc3 UTSW 8 106,825,782 (GRCm39) missense probably benign 0.23
R9538:Nfatc3 UTSW 8 106,834,784 (GRCm39) missense probably benign 0.35
R9656:Nfatc3 UTSW 8 106,830,766 (GRCm39) missense probably damaging 1.00
X0063:Nfatc3 UTSW 8 106,810,571 (GRCm39) missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106,834,981 (GRCm39) missense probably benign 0.04
Z1177:Nfatc3 UTSW 8 106,818,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCATCAAGGAACAGATGCTC -3'
(R):5'- CAGCCAATTCTCATCAGTGATAC -3'

Sequencing Primer
(F):5'- AGATGCTCATGAAGATGACCTAC -3'
(R):5'- CTCATCAGTGATACTAGATCTAGGAG -3'
Posted On 2019-10-17