Mutagenetix > Incidental Mutation

Incidental Mutation 'R7526:Nfatc3'

583003

Institutional Source

Beutler Lab

Gene Symbol

Nfatc3

Ensembl Gene

ENSMUSG00000031902

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3

Synonyms

NFATx, NFAT4, D8Ertd281e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7526 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106058840-106130537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106079083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 195 (S195P)

Ref Sequence

ENSEMBL: ENSMUSP00000104931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109308
AA Change: S195P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: S195P

Domain	Start	End	E-Value	Type
low complexity region	153	182	N/A	INTRINSIC
low complexity region	205	225	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	286	305	N/A	INTRINSIC
Pfam:RHD_DNA_bind	434	593	4.9e-25	PFAM
IPT	600	699	1.19e-20	SMART
low complexity region	713	722	N/A	INTRINSIC
low complexity region	917	938	N/A	INTRINSIC
low complexity region	954	967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211991
AA Change: S187P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212742
AA Change: S187P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2593

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700086D15Rik	A	T	11: 65,152,981	F85I	unknown	Het
Ankrd22	A	T	19: 34,149,365	W22R	possibly damaging	Het
Aqr	A	T	2: 114,108,109	H1287Q	probably damaging	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atp8b5	A	G	4: 43,366,609	E791G	probably damaging	Het
Bicd1	T	G	6: 149,513,726	S646A	possibly damaging	Het
Bmpr1b	A	T	3: 141,856,599	Y276N	probably damaging	Het
Cadps2	T	C	6: 23,496,851	H465R	probably damaging	Het
Card11	A	T	5: 140,913,429		probably null	Het
Ccdc9	A	G	7: 16,282,400	L139P	probably damaging	Het
Cdk5rap3	A	T	11: 96,909,945	M355K	probably benign	Het
Cnot2	A	T	10: 116,507,080	V116E	probably benign	Het
Defb48	A	G	14: 62,977,831	V32A	possibly damaging	Het
Dmkn	A	G	7: 30,777,651	D460G	possibly damaging	Het
Dmxl2	A	G	9: 54,400,957	V2170A	possibly damaging	Het
Dnah1	A	T	14: 31,287,876	F1912I	possibly damaging	Het
Dok3	C	T	13: 55,527,493	V71I	probably benign	Het
Dzip3	A	T	16: 48,975,474	F178Y	probably damaging	Het
Enpp1	T	C	10: 24,674,410		probably null	Het
Eogt	A	G	6: 97,113,952	F409L	probably damaging	Het
Erich6	A	T	3: 58,630,689	L218H	probably damaging	Het
Fam186a	G	C	15: 99,941,915	I2149M	possibly damaging	Het
Fat1	G	A	8: 45,023,427	V1837I	probably damaging	Het
Flrt3	T	A	2: 140,660,206	T501S	probably damaging	Het
Fmn1	A	C	2: 113,688,134	E1365D	probably damaging	Het
Fzd5	G	T	1: 64,736,092	P170Q	probably benign	Het
Gm13101	A	T	4: 143,965,817	C205S	probably benign	Het
Gm14326	G	A	2: 177,946,505	H233Y	probably damaging	Het
Gm19410	G	A	8: 35,790,612	V735M	probably damaging	Het
Gm21886	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	18: 80,089,825		probably benign	Het
Gm2832	A	T	14: 41,280,962	I143L		Het
Gm7534	T	C	4: 134,200,073		probably null	Het
Greb1	G	A	12: 16,716,765	T344I	probably benign	Het
Grik2	A	T	10: 49,523,822	Y271N	possibly damaging	Het
Grin3b	A	G	10: 79,973,051	N212D	probably benign	Het
Hgsnat	A	G	8: 25,971,049	L187P	probably damaging	Het
Hmcn1	A	G	1: 150,656,573	I3152T	probably damaging	Het
Hsp90aa1	A	T	12: 110,695,294	I96N	unknown	Het
Il18r1	T	A	1: 40,471,772	L6I	probably damaging	Het
Ing3	G	A	6: 21,953,799	V80I	probably damaging	Het
Kif18b	T	C	11: 102,914,667	I255V	probably damaging	Het
Kif2c	A	T	4: 117,182,432	N20K	possibly damaging	Het
Mfsd6l	T	C	11: 68,558,038	W572R	probably damaging	Het
Mybphl	A	G	3: 108,374,180	T71A	probably benign	Het
Myo7a	G	T	7: 98,085,448	T613K	possibly damaging	Het
Nrg1	T	C	8: 31,818,323	N603S	probably benign	Het
Olfr1054	A	T	2: 86,333,353	M1K	probably null	Het
Olfr1084	A	G	2: 86,639,669	I13T	possibly damaging	Het
Olfr629	T	C	7: 103,740,400	Y280C	probably damaging	Het
Parp8	T	C	13: 116,894,805	E457G	probably damaging	Het
Pclo	T	C	5: 14,521,062	F154L	probably benign	Het
Pear1	A	G	3: 87,752,568	S704P	probably damaging	Het
Pkib	A	G	10: 57,736,298	T92A	probably benign	Het
Pnpla7	A	G	2: 24,998,666	R376G	possibly damaging	Het
Ptprd	T	A	4: 76,066,327	E527D	probably benign	Het
Pum1	T	C	4: 130,747,026	V469A	probably damaging	Het
Rnf148	G	A	6: 23,654,284	Q238*	probably null	Het
Scn9a	A	C	2: 66,483,646	N1909K	probably benign	Het
Sema3c	A	T	5: 17,727,596	H699L	possibly damaging	Het
Sema3f	A	T	9: 107,689,728	C201S	probably damaging	Het
Serinc2	T	A	4: 130,258,790	D206V	probably benign	Het
Serping1	A	T	2: 84,767,293	S415T	probably benign	Het
Sirpb1b	A	T	3: 15,548,872	L50Q	probably damaging	Het
Slc25a22	T	C	7: 141,431,383	E262G	probably benign	Het
Slc5a8	A	G	10: 88,902,491	I205M	probably damaging	Het
Sod2	G	T	17: 13,008,031		probably benign	Het
Tec	T	C	5: 72,786,019	I118V	probably benign	Het
Tenm3	A	T	8: 48,287,812	V1212E	probably damaging	Het
Tex44	G	A	1: 86,426,515	V49I	probably benign	Het
Tmem132d	A	T	5: 127,784,141	L972*	probably null	Het
Tpte	G	A	8: 22,325,547		probably null	Het
Trim6	T	A	7: 104,232,832	I456N	probably damaging	Het
Ubr4	G	C	4: 139,422,417	V520L	probably benign	Het
Ubxn8	A	T	8: 33,633,607	N101K	probably benign	Het
Vmn2r60	AG	A	7: 42,195,734		probably null	Het
Vmn2r83	A	G	10: 79,491,558	T667A	probably damaging	Het

Other mutations in Nfatc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Nfatc3	APN	8	106099177	missense	probably damaging	1.00
IGL01755:Nfatc3	APN	8	106127921	missense	probably benign	0.42
IGL02314:Nfatc3	APN	8	106078900	missense	probably benign	0.21
IGL02724:Nfatc3	APN	8	106108185	missense	probably benign	0.29
Kampf	UTSW	8	106099150	missense	probably benign	0.23
Struggles	UTSW	8	106083870	nonsense	probably null
PIT1430001:Nfatc3	UTSW	8	106059973	missense	possibly damaging	0.78
PIT4515001:Nfatc3	UTSW	8	106079203	missense	possibly damaging	0.94
R0088:Nfatc3	UTSW	8	106127942	missense	possibly damaging	0.90
R0348:Nfatc3	UTSW	8	106092195	missense	probably damaging	1.00
R0410:Nfatc3	UTSW	8	106096196	missense	probably damaging	1.00
R1509:Nfatc3	UTSW	8	106083854	missense	possibly damaging	0.46
R1702:Nfatc3	UTSW	8	106092160	missense	probably damaging	1.00
R1735:Nfatc3	UTSW	8	106083834	missense	probably damaging	1.00
R1736:Nfatc3	UTSW	8	106078850	missense	probably damaging	1.00
R1758:Nfatc3	UTSW	8	106099136	missense	probably damaging	1.00
R2370:Nfatc3	UTSW	8	106108455	missense	probably damaging	1.00
R2878:Nfatc3	UTSW	8	106092144	missense	probably damaging	1.00
R3802:Nfatc3	UTSW	8	106079645	missense	probably damaging	0.99
R3959:Nfatc3	UTSW	8	106099077	nonsense	probably null
R4006:Nfatc3	UTSW	8	106108839	missense	probably benign	0.00
R4079:Nfatc3	UTSW	8	106079491	missense	probably damaging	0.98
R4589:Nfatc3	UTSW	8	106079073	missense	probably damaging	1.00
R4818:Nfatc3	UTSW	8	106108379	missense	probably benign	0.00
R4907:Nfatc3	UTSW	8	106079727	missense	probably damaging	1.00
R5042:Nfatc3	UTSW	8	106108125	missense	probably benign	0.25
R5632:Nfatc3	UTSW	8	106079057	missense	probably damaging	1.00
R5741:Nfatc3	UTSW	8	106079066	missense	probably damaging	1.00
R5885:Nfatc3	UTSW	8	106096312	missense	probably benign	0.00
R6439:Nfatc3	UTSW	8	106083870	nonsense	probably null
R6557:Nfatc3	UTSW	8	106119354	missense	probably benign	0.01
R6737:Nfatc3	UTSW	8	106083969	missense	probably damaging	1.00
R6925:Nfatc3	UTSW	8	106119322	missense	probably benign	0.00
R7260:Nfatc3	UTSW	8	106108946	missense	probably benign	0.00
R7429:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7430:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7760:Nfatc3	UTSW	8	106108341	missense	possibly damaging	0.66
R8783:Nfatc3	UTSW	8	106099152	missense	possibly damaging	0.63
R8867:Nfatc3	UTSW	8	106079008	missense	probably damaging	1.00
R8978:Nfatc3	UTSW	8	106108770	missense	probably benign	0.03
R9021:Nfatc3	UTSW	8	106092113	missense	probably damaging	1.00
R9066:Nfatc3	UTSW	8	106099150	missense	probably benign	0.23
R9538:Nfatc3	UTSW	8	106108152	missense	probably benign	0.35
R9656:Nfatc3	UTSW	8	106104134	missense	probably damaging	1.00
X0063:Nfatc3	UTSW	8	106083939	missense	probably damaging	1.00
X0064:Nfatc3	UTSW	8	106108349	missense	probably benign	0.04
Z1177:Nfatc3	UTSW	8	106092066	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCATCAAGGAACAGATGCTC -3'
(R):5'- CAGCCAATTCTCATCAGTGATAC -3'

Sequencing Primer
(F):5'- AGATGCTCATGAAGATGACCTAC -3'
(R):5'- CTCATCAGTGATACTAGATCTAGGAG -3'

Posted On

2019-10-17