Incidental Mutation 'R7526:Grik2'
ID 583006
Institutional Source Beutler Lab
Gene Symbol Grik2
Ensembl Gene ENSMUSG00000056073
Gene Name glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms Glur6, C130030K03Rik, Glurbeta2, Glur-6
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 48970929-49664862 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 49399918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 271 (Y271N)
Ref Sequence ENSEMBL: ENSMUSP00000101124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218669] [ENSMUST00000218823] [ENSMUST00000220263]
AlphaFold P39087
Predicted Effect probably benign
Transcript: ENSMUST00000079751
AA Change: Y271N

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: Y271N

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000105484
AA Change: Y271N

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: Y271N

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000218441
AA Change: Y271N

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218598
AA Change: Y271N

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000218669
Predicted Effect possibly damaging
Transcript: ENSMUST00000218823
AA Change: Y271N

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000220263
AA Change: Y271N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.3017 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bicd1 T G 6: 149,415,224 (GRCm39) S646A possibly damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Ccdc9 A G 7: 16,016,325 (GRCm39) L139P probably damaging Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Ing3 G A 6: 21,953,798 (GRCm39) V80I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Kif2c A T 4: 117,039,629 (GRCm39) N20K possibly damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nfatc3 T C 8: 106,805,715 (GRCm39) S195P probably damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Ptprd T A 4: 75,984,564 (GRCm39) E527D probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Ubxn8 A T 8: 34,123,635 (GRCm39) N101K probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Grik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Grik2 APN 10 49,232,024 (GRCm39) missense possibly damaging 0.95
IGL00979:Grik2 APN 10 49,232,034 (GRCm39) missense probably damaging 1.00
IGL01012:Grik2 APN 10 49,149,052 (GRCm39) missense probably damaging 1.00
IGL01302:Grik2 APN 10 49,120,426 (GRCm39) missense probably damaging 0.99
IGL01657:Grik2 APN 10 49,404,082 (GRCm39) critical splice donor site probably null
IGL02162:Grik2 APN 10 49,298,671 (GRCm39) missense possibly damaging 0.77
IGL02317:Grik2 APN 10 49,298,711 (GRCm39) missense probably benign 0.16
IGL02512:Grik2 APN 10 49,232,008 (GRCm39) missense probably benign 0.00
IGL02650:Grik2 APN 10 48,977,331 (GRCm39) missense probably benign 0.03
IGL03283:Grik2 APN 10 49,454,365 (GRCm39) missense probably benign 0.00
BB004:Grik2 UTSW 10 49,116,890 (GRCm39) missense probably damaging 1.00
BB014:Grik2 UTSW 10 49,116,890 (GRCm39) missense probably damaging 1.00
R0325:Grik2 UTSW 10 49,116,821 (GRCm39) missense probably damaging 1.00
R0492:Grik2 UTSW 10 48,977,260 (GRCm39) missense probably damaging 0.99
R0601:Grik2 UTSW 10 49,298,693 (GRCm39) missense probably damaging 1.00
R0844:Grik2 UTSW 10 48,977,211 (GRCm39) missense possibly damaging 0.81
R1333:Grik2 UTSW 10 49,404,087 (GRCm39) missense probably damaging 0.98
R1499:Grik2 UTSW 10 49,008,871 (GRCm39) missense probably damaging 1.00
R1660:Grik2 UTSW 10 49,120,439 (GRCm39) nonsense probably null
R1721:Grik2 UTSW 10 49,399,842 (GRCm39) missense possibly damaging 0.93
R1966:Grik2 UTSW 10 49,232,005 (GRCm39) missense probably damaging 1.00
R1974:Grik2 UTSW 10 49,008,923 (GRCm39) missense possibly damaging 0.85
R2246:Grik2 UTSW 10 49,411,532 (GRCm39) missense probably damaging 1.00
R3103:Grik2 UTSW 10 49,116,868 (GRCm39) missense probably damaging 1.00
R3974:Grik2 UTSW 10 49,298,750 (GRCm39) missense probably damaging 1.00
R4592:Grik2 UTSW 10 49,298,711 (GRCm39) missense possibly damaging 0.48
R4658:Grik2 UTSW 10 49,399,888 (GRCm39) missense possibly damaging 0.71
R4748:Grik2 UTSW 10 49,411,437 (GRCm39) missense possibly damaging 0.87
R4935:Grik2 UTSW 10 49,116,826 (GRCm39) missense probably damaging 1.00
R4977:Grik2 UTSW 10 49,008,841 (GRCm39) missense probably damaging 1.00
R5103:Grik2 UTSW 10 49,372,205 (GRCm39) missense probably benign 0.33
R5330:Grik2 UTSW 10 49,008,867 (GRCm39) missense probably damaging 1.00
R5331:Grik2 UTSW 10 49,008,867 (GRCm39) missense probably damaging 1.00
R5736:Grik2 UTSW 10 49,280,506 (GRCm39) missense probably damaging 0.96
R5740:Grik2 UTSW 10 48,989,573 (GRCm39) missense probably damaging 0.99
R5747:Grik2 UTSW 10 49,399,870 (GRCm39) missense probably benign
R6015:Grik2 UTSW 10 49,399,959 (GRCm39) splice site probably null
R6311:Grik2 UTSW 10 49,454,234 (GRCm39) missense probably damaging 0.98
R6474:Grik2 UTSW 10 49,008,776 (GRCm39) missense probably benign
R6504:Grik2 UTSW 10 49,232,198 (GRCm39) missense probably damaging 1.00
R6591:Grik2 UTSW 10 49,149,021 (GRCm39) nonsense probably null
R6691:Grik2 UTSW 10 49,149,021 (GRCm39) nonsense probably null
R6776:Grik2 UTSW 10 49,232,085 (GRCm39) missense probably damaging 1.00
R7015:Grik2 UTSW 10 49,411,532 (GRCm39) missense probably damaging 1.00
R7094:Grik2 UTSW 10 49,232,012 (GRCm39) missense possibly damaging 0.75
R7153:Grik2 UTSW 10 49,411,463 (GRCm39) missense probably benign 0.00
R7229:Grik2 UTSW 10 48,977,512 (GRCm39) splice site probably null
R7402:Grik2 UTSW 10 49,411,493 (GRCm39) missense probably damaging 1.00
R7473:Grik2 UTSW 10 48,989,618 (GRCm39) missense probably benign 0.22
R7514:Grik2 UTSW 10 49,399,904 (GRCm39) missense probably damaging 0.99
R7657:Grik2 UTSW 10 49,659,247 (GRCm39) missense probably benign 0.11
R7681:Grik2 UTSW 10 49,120,476 (GRCm39) missense probably damaging 1.00
R7714:Grik2 UTSW 10 49,295,792 (GRCm39) missense probably damaging 0.97
R7927:Grik2 UTSW 10 49,116,890 (GRCm39) missense probably damaging 1.00
R7952:Grik2 UTSW 10 49,298,633 (GRCm39) missense probably benign 0.15
R7979:Grik2 UTSW 10 49,280,438 (GRCm39) missense probably benign 0.01
R8062:Grik2 UTSW 10 49,116,863 (GRCm39) missense probably damaging 1.00
R8222:Grik2 UTSW 10 49,449,744 (GRCm39) missense probably benign 0.29
R8406:Grik2 UTSW 10 49,148,863 (GRCm39) missense probably damaging 1.00
R9017:Grik2 UTSW 10 48,989,555 (GRCm39) missense possibly damaging 0.94
R9557:Grik2 UTSW 10 49,404,105 (GRCm39) missense probably damaging 1.00
RF008:Grik2 UTSW 10 49,120,480 (GRCm39) missense probably damaging 1.00
X0062:Grik2 UTSW 10 49,149,016 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGACCACATAATGCTAATAGG -3'
(R):5'- GTATCTAATTGATTGGCAATACTTGGC -3'

Sequencing Primer
(F):5'- ACTGTTTACATCCAGATAGCTTAAAG -3'
(R):5'- CAATACTTGGCAGATGTTGAGATACG -3'
Posted On 2019-10-17