Incidental Mutation 'R7526:Vmn2r83'
ID 583008
Institutional Source Beutler Lab
Gene Symbol Vmn2r83
Ensembl Gene ENSMUSG00000091381
Gene Name vomeronasal 2, receptor 83
Synonyms EG625029
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 79468943-79492154 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79491558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 667 (T667A)
Ref Sequence ENSEMBL: ENSMUSP00000131426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167976]
AlphaFold E9Q0G7
Predicted Effect probably damaging
Transcript: ENSMUST00000167976
AA Change: T667A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131426
Gene: ENSMUSG00000091381
AA Change: T667A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 473 1.5e-33 PFAM
Pfam:NCD3G 516 569 6.2e-22 PFAM
Pfam:7tm_3 602 837 8.1e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Vmn2r83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Vmn2r83 APN 10 79478971 missense probably damaging 1.00
IGL01096:Vmn2r83 APN 10 79477828 missense probably damaging 1.00
IGL01542:Vmn2r83 APN 10 79479012 missense probably benign 0.30
IGL01803:Vmn2r83 APN 10 79469060 missense probably benign 0.01
IGL02110:Vmn2r83 APN 10 79491700 missense possibly damaging 0.82
IGL02347:Vmn2r83 APN 10 79480233 missense possibly damaging 0.75
IGL02417:Vmn2r83 APN 10 79479047 missense probably benign 0.00
IGL02544:Vmn2r83 APN 10 79481459 splice site probably benign
IGL02683:Vmn2r83 APN 10 79491281 missense probably benign
IGL02976:Vmn2r83 APN 10 79468998 missense probably benign 0.00
PIT4378001:Vmn2r83 UTSW 10 79469015 missense probably benign 0.00
PIT4468001:Vmn2r83 UTSW 10 79478050 missense probably damaging 1.00
R0092:Vmn2r83 UTSW 10 79491964 missense probably damaging 1.00
R1391:Vmn2r83 UTSW 10 79479097 missense probably damaging 0.96
R1539:Vmn2r83 UTSW 10 79491925 missense probably damaging 1.00
R1575:Vmn2r83 UTSW 10 79479122 missense probably damaging 0.98
R2033:Vmn2r83 UTSW 10 79491819 missense probably benign 0.03
R3916:Vmn2r83 UTSW 10 79478910 missense probably benign 0.01
R3967:Vmn2r83 UTSW 10 79491320 missense probably benign 0.00
R4840:Vmn2r83 UTSW 10 79477848 missense possibly damaging 0.73
R5063:Vmn2r83 UTSW 10 79479087 missense probably benign 0.04
R5630:Vmn2r83 UTSW 10 79491951 missense possibly damaging 0.94
R5707:Vmn2r83 UTSW 10 79491349 missense possibly damaging 0.53
R5980:Vmn2r83 UTSW 10 79478792 missense probably benign 0.04
R6294:Vmn2r83 UTSW 10 79477854 missense probably damaging 0.99
R6302:Vmn2r83 UTSW 10 79469003 missense possibly damaging 0.95
R6769:Vmn2r83 UTSW 10 79478022 missense probably damaging 1.00
R6986:Vmn2r83 UTSW 10 79480259 missense probably benign
R7221:Vmn2r83 UTSW 10 79480167 missense probably benign 0.02
R7376:Vmn2r83 UTSW 10 79478956 missense probably benign 0.00
R7431:Vmn2r83 UTSW 10 79491472 missense probably damaging 0.99
R7501:Vmn2r83 UTSW 10 79491937 missense probably damaging 0.98
R7663:Vmn2r83 UTSW 10 79479122 missense probably damaging 0.98
R7881:Vmn2r83 UTSW 10 79478427 missense probably benign 0.01
R7939:Vmn2r83 UTSW 10 79478817 missense probably damaging 1.00
R8314:Vmn2r83 UTSW 10 79481479 missense possibly damaging 0.76
R8364:Vmn2r83 UTSW 10 79480203 missense probably benign 0.12
R8802:Vmn2r83 UTSW 10 79478427 missense probably benign 0.01
R8947:Vmn2r83 UTSW 10 79469039 missense probably benign 0.00
R8969:Vmn2r83 UTSW 10 79478019 missense probably benign 0.15
R8983:Vmn2r83 UTSW 10 79491526 missense probably damaging 1.00
R9018:Vmn2r83 UTSW 10 79480186 missense probably damaging 1.00
R9082:Vmn2r83 UTSW 10 79469060 missense probably benign 0.00
R9390:Vmn2r83 UTSW 10 79481488 nonsense probably null
X0026:Vmn2r83 UTSW 10 79469015 missense probably benign 0.00
X0026:Vmn2r83 UTSW 10 79478652 missense probably benign
Z1176:Vmn2r83 UTSW 10 79478922 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGGGATTCTCTGCACTCACTAC -3'
(R):5'- AGCATCCATGTCAATAAATGGAGG -3'

Sequencing Primer
(F):5'- GCACTCACTACTCTTATTATCGGGG -3'
(R):5'- GGAAACGTTCCCAGCCATATTC -3'
Posted On 2019-10-17