Incidental Mutation 'R7526:Grin3b'
ID 583009
Institutional Source Beutler Lab
Gene Symbol Grin3b
Ensembl Gene ENSMUSG00000035745
Gene Name glutamate receptor, ionotropic, NMDA3B
Synonyms NR3B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 79970715-79977190 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79973051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 212 (N212D)
Ref Sequence ENSEMBL: ENSMUSP00000048576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045085] [ENSMUST00000045247] [ENSMUST00000052885]
AlphaFold Q91ZU9
Predicted Effect probably benign
Transcript: ENSMUST00000045085
AA Change: N212D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048576
Gene: ENSMUSG00000035745
AA Change: N212D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 60 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
PBPe 458 810 1.01e-82 SMART
Lig_chan-Glu_bd 459 522 6.6e-20 SMART
transmembrane domain 826 848 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
coiled coil region 950 984 N/A INTRINSIC
low complexity region 989 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045247
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052885
SMART Domains Protein: ENSMUSP00000056792
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 34 131 3.3e-44 PFAM
Pfam:Membralin 138 393 3.9e-130 PFAM
transmembrane domain 394 411 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 483 521 N/A INTRINSIC
low complexity region 531 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124536
SMART Domains Protein: ENSMUSP00000119572
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 4 101 1.6e-44 PFAM
Pfam:Membralin 108 297 7.7e-83 PFAM
Pfam:Membralin 316 387 5e-42 PFAM
transmembrane domain 388 405 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 477 515 N/A INTRINSIC
low complexity region 525 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131816
SMART Domains Protein: ENSMUSP00000122984
Gene: ENSMUSG00000035745

DomainStartEndE-ValueType
Pfam:Lig_chan 1 368 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149148
SMART Domains Protein: ENSMUSP00000116887
Gene: ENSMUSG00000035745

DomainStartEndE-ValueType
PBPe 100 452 1.01e-82 SMART
Lig_chan-Glu_bd 101 164 6.6e-20 SMART
transmembrane domain 468 490 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of an N-methyl-D-aspartate (NMDA) receptor. The encoded protein is found primarily in motor neurons, where it forms a heterotetramer with GRIN1 to create an excitatory glycine receptor. Variations in this gene have been proposed to be linked to schizophrenia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele show a mild impairment in motor learning or coordination, reduced home cage activity, a highly increased social interaction with familiar cagemates in their home cage but moderately increased anxiety-like behavior and reduced social interaction in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Grin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02754:Grin3b APN 10 79972889 missense possibly damaging 0.50
IGL03352:Grin3b APN 10 79973781 missense probably damaging 0.99
R0485:Grin3b UTSW 10 79974056 missense possibly damaging 0.68
R0927:Grin3b UTSW 10 79971228 missense probably benign 0.04
R1526:Grin3b UTSW 10 79974602 missense probably damaging 1.00
R1699:Grin3b UTSW 10 79975882 missense probably damaging 0.99
R1789:Grin3b UTSW 10 79973408 missense probably benign
R1916:Grin3b UTSW 10 79974598 missense probably damaging 1.00
R1991:Grin3b UTSW 10 79970912 missense probably benign
R1991:Grin3b UTSW 10 79974646 missense probably damaging 1.00
R4359:Grin3b UTSW 10 79972897 missense probably benign 0.00
R4817:Grin3b UTSW 10 79976898 missense probably benign 0.01
R4909:Grin3b UTSW 10 79977104 makesense probably null
R4942:Grin3b UTSW 10 79975722 missense probably damaging 0.99
R4981:Grin3b UTSW 10 79976357 intron probably benign
R5689:Grin3b UTSW 10 79974631 missense probably damaging 1.00
R5910:Grin3b UTSW 10 79973021 missense probably benign 0.00
R6132:Grin3b UTSW 10 79976440 missense probably damaging 1.00
R6242:Grin3b UTSW 10 79976179 missense probably damaging 1.00
R6262:Grin3b UTSW 10 79974369 missense probably benign 0.38
R6336:Grin3b UTSW 10 79976461 missense probably damaging 1.00
R6942:Grin3b UTSW 10 79976119 critical splice donor site probably null
R7201:Grin3b UTSW 10 79974078 missense possibly damaging 0.96
R7322:Grin3b UTSW 10 79975695 missense probably damaging 1.00
R7707:Grin3b UTSW 10 79975901 missense possibly damaging 0.89
R7980:Grin3b UTSW 10 79975725 missense possibly damaging 0.75
R8069:Grin3b UTSW 10 79977034 missense unknown
R8128:Grin3b UTSW 10 79977110 missense
R8434:Grin3b UTSW 10 79974588 missense probably damaging 1.00
R8777:Grin3b UTSW 10 79973138 missense possibly damaging 0.96
R8777-TAIL:Grin3b UTSW 10 79973138 missense possibly damaging 0.96
R8848:Grin3b UTSW 10 79973833 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGACCATCCTGGATGTGCTG -3'
(R):5'- ACAAGCTCCACCATGTCGTG -3'

Sequencing Primer
(F):5'- CCTGGATGTGCTGGTGTCCC -3'
(R):5'- CAGACCGGTTTTGGGCAG -3'
Posted On 2019-10-17