Incidental Mutation 'R7526:Slc5a8'
ID 583010
Institutional Source Beutler Lab
Gene Symbol Slc5a8
Ensembl Gene ENSMUSG00000020062
Gene Name solute carrier family 5 (iodide transporter), member 8
Synonyms SMCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 88885992-88929515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88902491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 205 (I205M)
Ref Sequence ENSEMBL: ENSMUSP00000020255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020255]
AlphaFold Q8BYF6
Predicted Effect probably damaging
Transcript: ENSMUST00000020255
AA Change: I205M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: I205M

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:SSF 45 449 2.6e-38 PFAM
low complexity region 462 478 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 M355K probably benign Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Slc5a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Slc5a8 APN 10 88908040 missense possibly damaging 0.91
IGL00902:Slc5a8 APN 10 88919461 missense probably benign 0.03
IGL00960:Slc5a8 APN 10 88921765 missense probably benign 0.21
IGL01109:Slc5a8 APN 10 88906392 missense possibly damaging 0.95
IGL01365:Slc5a8 APN 10 88892097 splice site probably benign
IGL01418:Slc5a8 APN 10 88905033 missense probably damaging 1.00
IGL01823:Slc5a8 APN 10 88919472 nonsense probably null
IGL02116:Slc5a8 APN 10 88919500 missense probably benign
IGL03109:Slc5a8 APN 10 88906416 splice site probably benign
PIT4585001:Slc5a8 UTSW 10 88886503 missense probably damaging 1.00
R0010:Slc5a8 UTSW 10 88886590 missense probably benign 0.03
R0418:Slc5a8 UTSW 10 88886558 missense probably benign 0.01
R1233:Slc5a8 UTSW 10 88918442 missense probably damaging 1.00
R1656:Slc5a8 UTSW 10 88925786 critical splice donor site probably null
R1769:Slc5a8 UTSW 10 88919464 missense probably benign
R1769:Slc5a8 UTSW 10 88919466 nonsense probably null
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2873:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R3883:Slc5a8 UTSW 10 88902463 missense possibly damaging 0.89
R4207:Slc5a8 UTSW 10 88911413 missense probably damaging 1.00
R4731:Slc5a8 UTSW 10 88925787 critical splice donor site probably null
R4880:Slc5a8 UTSW 10 88892024 missense probably damaging 1.00
R4969:Slc5a8 UTSW 10 88904912 splice site probably null
R4998:Slc5a8 UTSW 10 88908057 critical splice donor site probably null
R5009:Slc5a8 UTSW 10 88909654 missense probably benign 0.07
R5068:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5069:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5070:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5130:Slc5a8 UTSW 10 88926215 missense probably benign
R5141:Slc5a8 UTSW 10 88919560 critical splice donor site probably null
R5252:Slc5a8 UTSW 10 88906347 missense probably damaging 1.00
R5659:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5660:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5661:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6378:Slc5a8 UTSW 10 88905054 missense probably damaging 1.00
R7214:Slc5a8 UTSW 10 88919502 missense probably benign
R7255:Slc5a8 UTSW 10 88909631 missense probably damaging 1.00
R7604:Slc5a8 UTSW 10 88904960 missense possibly damaging 0.78
R7688:Slc5a8 UTSW 10 88921699 missense probably damaging 1.00
R7869:Slc5a8 UTSW 10 88921705 missense probably benign 0.15
R8219:Slc5a8 UTSW 10 88921699 missense probably damaging 1.00
R8474:Slc5a8 UTSW 10 88921690 missense possibly damaging 0.69
R8937:Slc5a8 UTSW 10 88905023 missense probably damaging 1.00
R8960:Slc5a8 UTSW 10 88886173 start gained probably benign
R9000:Slc5a8 UTSW 10 88926227 missense probably benign 0.00
R9000:Slc5a8 UTSW 10 88926228 missense probably benign 0.13
R9792:Slc5a8 UTSW 10 88921729 missense possibly damaging 0.55
R9795:Slc5a8 UTSW 10 88921729 missense possibly damaging 0.55
Z1177:Slc5a8 UTSW 10 88909613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCTCCTTCGAGGGAAC -3'
(R):5'- TGCCCACTTTAATTTTACAGACCAC -3'

Sequencing Primer
(F):5'- TTCGAGGGAACTTCTTGACCAAAC -3'
(R):5'- CAGACCACATCATTAGTGACTTATTG -3'
Posted On 2019-10-17