Incidental Mutation 'R7526:Cdk5rap3'
ID 583014
Institutional Source Beutler Lab
Gene Symbol Cdk5rap3
Ensembl Gene ENSMUSG00000018669
Gene Name CDK5 regulatory subunit associated protein 3
Synonyms HSF-27, IC53, OK/SW-cl.114, 1810007E24Rik, MST016, C53
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 96907426-96916496 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96909945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 355 (M355K)
Ref Sequence ENSEMBL: ENSMUSP00000099441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103152] [ENSMUST00000127048] [ENSMUST00000130774] [ENSMUST00000134732] [ENSMUST00000144731] [ENSMUST00000147573] [ENSMUST00000153305] [ENSMUST00000156315]
AlphaFold Q99LM2
Predicted Effect probably benign
Transcript: ENSMUST00000103152
AA Change: M355K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099441
Gene: ENSMUSG00000018669
AA Change: M355K

DomainStartEndE-ValueType
Pfam:DUF773 4 500 3.7e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127048
SMART Domains Protein: ENSMUSP00000114849
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 145 1.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130774
SMART Domains Protein: ENSMUSP00000114661
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 80 1.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134732
SMART Domains Protein: ENSMUSP00000120258
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 107 4.7e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144731
SMART Domains Protein: ENSMUSP00000114724
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 124 9.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147573
Predicted Effect probably benign
Transcript: ENSMUST00000153305
SMART Domains Protein: ENSMUSP00000116405
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 115 4.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156315
SMART Domains Protein: ENSMUSP00000123113
Gene: ENSMUSG00000018669

DomainStartEndE-ValueType
Pfam:DUF773 1 140 2.2e-79 PFAM
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been reported to function in signaling pathways governing transcriptional regulation and cell cycle progression. It may play a role in tumorigenesis and metastasis. A pseudogene of this gene is located on the long arm of chromosome 20. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 F85I unknown Het
Ankrd22 A T 19: 34,149,365 W22R possibly damaging Het
Aqr A T 2: 114,108,109 H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp8b5 A G 4: 43,366,609 E791G probably damaging Het
Bicd1 T G 6: 149,513,726 S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 H465R probably damaging Het
Card11 A T 5: 140,913,429 probably null Het
Ccdc9 A G 7: 16,282,400 L139P probably damaging Het
Cnot2 A T 10: 116,507,080 V116E probably benign Het
Defb48 A G 14: 62,977,831 V32A possibly damaging Het
Dmkn A G 7: 30,777,651 D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 V2170A possibly damaging Het
Dnah1 A T 14: 31,287,876 F1912I possibly damaging Het
Dok3 C T 13: 55,527,493 V71I probably benign Het
Dzip3 A T 16: 48,975,474 F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 probably null Het
Eogt A G 6: 97,113,952 F409L probably damaging Het
Erich6 A T 3: 58,630,689 L218H probably damaging Het
Fam186a G C 15: 99,941,915 I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 T501S probably damaging Het
Fmn1 A C 2: 113,688,134 E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 P170Q probably benign Het
Gm13101 A T 4: 143,965,817 C205S probably benign Het
Gm14326 G A 2: 177,946,505 H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm2832 A T 14: 41,280,962 I143L Het
Gm7534 T C 4: 134,200,073 probably null Het
Greb1 G A 12: 16,716,765 T344I probably benign Het
Grik2 A T 10: 49,523,822 Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 N212D probably benign Het
Hgsnat A G 8: 25,971,049 L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 I96N unknown Het
Il18r1 T A 1: 40,471,772 L6I probably damaging Het
Ing3 G A 6: 21,953,799 V80I probably damaging Het
Kif18b T C 11: 102,914,667 I255V probably damaging Het
Kif2c A T 4: 117,182,432 N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 W572R probably damaging Het
Mybphl A G 3: 108,374,180 T71A probably benign Het
Myo7a G T 7: 98,085,448 T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 S195P probably damaging Het
Nrg1 T C 8: 31,818,323 N603S probably benign Het
Olfr1054 A T 2: 86,333,353 M1K probably null Het
Olfr1084 A G 2: 86,639,669 I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 Y280C probably damaging Het
Parp8 T C 13: 116,894,805 E457G probably damaging Het
Pclo T C 5: 14,521,062 F154L probably benign Het
Pear1 A G 3: 87,752,568 S704P probably damaging Het
Pkib A G 10: 57,736,298 T92A probably benign Het
Pnpla7 A G 2: 24,998,666 R376G possibly damaging Het
Ptprd T A 4: 76,066,327 E527D probably benign Het
Pum1 T C 4: 130,747,026 V469A probably damaging Het
Rnf148 G A 6: 23,654,284 Q238* probably null Het
Scn9a A C 2: 66,483,646 N1909K probably benign Het
Sema3c A T 5: 17,727,596 H699L possibly damaging Het
Sema3f A T 9: 107,689,728 C201S probably damaging Het
Serinc2 T A 4: 130,258,790 D206V probably benign Het
Serping1 A T 2: 84,767,293 S415T probably benign Het
Sirpb1b A T 3: 15,548,872 L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 E262G probably benign Het
Slc5a8 A G 10: 88,902,491 I205M probably damaging Het
Sod2 G T 17: 13,008,031 probably benign Het
Tec T C 5: 72,786,019 I118V probably benign Het
Tenm3 A T 8: 48,287,812 V1212E probably damaging Het
Tex44 G A 1: 86,426,515 V49I probably benign Het
Tmem132d A T 5: 127,784,141 L972* probably null Het
Tpte G A 8: 22,325,547 probably null Het
Trim6 T A 7: 104,232,832 I456N probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Ubxn8 A T 8: 33,633,607 N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vmn2r83 A G 10: 79,491,558 T667A probably damaging Het
Other mutations in Cdk5rap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cdk5rap3 APN 11 96913399 missense probably damaging 1.00
IGL00958:Cdk5rap3 APN 11 96909967 missense probably benign 0.04
IGL00964:Cdk5rap3 APN 11 96909939 critical splice donor site probably null
IGL01767:Cdk5rap3 APN 11 96913465 missense probably damaging 1.00
IGL02321:Cdk5rap3 APN 11 96913465 missense probably damaging 1.00
IGL02352:Cdk5rap3 APN 11 96916177 missense probably damaging 1.00
R0032:Cdk5rap3 UTSW 11 96908753 missense possibly damaging 0.61
R0894:Cdk5rap3 UTSW 11 96908828 missense probably damaging 1.00
R1795:Cdk5rap3 UTSW 11 96908828 missense probably damaging 1.00
R5035:Cdk5rap3 UTSW 11 96916085 utr 5 prime probably benign
R5530:Cdk5rap3 UTSW 11 96911633 nonsense probably null
R5782:Cdk5rap3 UTSW 11 96911586 missense probably benign 0.01
R6278:Cdk5rap3 UTSW 11 96911903 missense probably damaging 1.00
R6888:Cdk5rap3 UTSW 11 96916192 missense probably benign 0.33
R8197:Cdk5rap3 UTSW 11 96916149 critical splice donor site probably null
R8784:Cdk5rap3 UTSW 11 96912386 missense probably benign 0.35
Z1177:Cdk5rap3 UTSW 11 96912216 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGAGGTTTGCCATGTAGC -3'
(R):5'- TTTATCGGCCAGACCCAAG -3'

Sequencing Primer
(F):5'- ATTGCTACTGCCCAAGATGG -3'
(R):5'- TTTATCGGCCAGACCCAAGTAGAAC -3'
Posted On 2019-10-17