Incidental Mutation 'R0616:Acnat2'
ID 58302
Institutional Source Beutler Lab
Gene Symbol Acnat2
Ensembl Gene ENSMUSG00000060317
Gene Name acyl-coenzyme A amino acid N-acyltransferase 2
Synonyms C730036D15Rik
MMRRC Submission 038805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R0616 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 49379840-49408151 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49380269 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 370 (S370P)
Ref Sequence ENSEMBL: ENSMUSP00000080256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081541] [ENSMUST00000107698] [ENSMUST00000125123]
AlphaFold Q8BGG9
Predicted Effect probably damaging
Transcript: ENSMUST00000081541
AA Change: S370P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080256
Gene: ENSMUSG00000060317
AA Change: S370P

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 144 6e-44 PFAM
low complexity region 149 173 N/A INTRINSIC
Pfam:BAAT_C 206 415 2e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107698
AA Change: S352P

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103326
Gene: ENSMUSG00000060317
AA Change: S352P

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 9.8e-42 PFAM
Pfam:BAAT_C 188 397 6.6e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125123
SMART Domains Protein: ENSMUSP00000119135
Gene: ENSMUSG00000060317

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 2.4e-42 PFAM
low complexity region 149 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139564
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,341,830 (GRCm39) Q1044K probably damaging Het
Abi3bp A T 16: 56,474,433 (GRCm39) T723S probably damaging Het
Ackr3 G A 1: 90,142,191 (GRCm39) V217I probably benign Het
Arap1 A G 7: 101,050,857 (GRCm39) R1152G possibly damaging Het
Arhgap15 G A 2: 44,006,729 (GRCm39) probably null Het
Arhgap5 C T 12: 52,563,848 (GRCm39) T273I possibly damaging Het
Armh4 G T 14: 50,011,113 (GRCm39) T198K possibly damaging Het
C1s2 T C 6: 124,605,723 (GRCm39) E332G probably damaging Het
Camp G A 9: 109,677,707 (GRCm39) R88W probably benign Het
Cdkl2 A G 5: 92,156,863 (GRCm39) M564T probably benign Het
Ceacam20 A G 7: 19,704,321 (GRCm39) H124R probably benign Het
Cep19 C T 16: 31,922,829 (GRCm39) R32C probably damaging Het
Cep295 G A 9: 15,243,618 (GRCm39) Q1565* probably null Het
Chd3 T C 11: 69,236,313 (GRCm39) E1932G probably damaging Het
Cibar1 G A 4: 12,168,234 (GRCm39) R210* probably null Het
Cnr2 G T 4: 135,644,873 (GRCm39) W317L probably benign Het
Cntnap5a C T 1: 116,508,279 (GRCm39) H1264Y possibly damaging Het
Depdc7 T A 2: 104,557,650 (GRCm39) N200I probably benign Het
Dock4 T C 12: 40,754,414 (GRCm39) S468P probably benign Het
Dscc1 C A 15: 54,946,966 (GRCm39) C253F probably benign Het
Fam217a C A 13: 35,097,666 (GRCm39) S55I probably benign Het
Farp1 G A 14: 121,514,434 (GRCm39) R921H probably damaging Het
Fat4 A G 3: 38,997,019 (GRCm39) D1746G probably damaging Het
Fbxw5 T C 2: 25,392,517 (GRCm39) F100L probably damaging Het
Gli3 C A 13: 15,836,991 (GRCm39) T458K possibly damaging Het
Gm4841 T C 18: 60,404,009 (GRCm39) Y28C probably benign Het
Gprc5d T C 6: 135,093,430 (GRCm39) E159G probably benign Het
Grm4 A T 17: 27,653,538 (GRCm39) I757N probably damaging Het
Hagh A G 17: 25,076,551 (GRCm39) Y94C probably damaging Het
Hycc1 T C 5: 24,191,770 (GRCm39) T44A probably damaging Het
Itpkb T C 1: 180,249,301 (GRCm39) I892T probably damaging Het
Kcmf1 T C 6: 72,827,467 (GRCm39) I58V probably benign Het
Khdrbs2 A G 1: 32,506,856 (GRCm39) I167V possibly damaging Het
Kmt2c A G 5: 25,504,250 (GRCm39) I275T probably benign Het
Lingo4 A G 3: 94,310,388 (GRCm39) K442R probably benign Het
Mak T C 13: 41,195,661 (GRCm39) N382D probably benign Het
Maob G A X: 16,576,402 (GRCm39) T480I possibly damaging Het
Mcoln1 A G 8: 3,565,025 (GRCm39) E573G probably benign Het
Ms4a6b G A 19: 11,504,262 (GRCm39) probably null Het
Muc5ac A G 7: 141,349,981 (GRCm39) M576V probably benign Het
Nme8 T A 13: 19,875,029 (GRCm39) D126V probably benign Het
Npy2r T A 3: 82,448,670 (GRCm39) D35V possibly damaging Het
Nrxn1 T C 17: 90,670,285 (GRCm39) D193G probably damaging Het
Or2g7 A C 17: 38,378,131 (GRCm39) E23A probably damaging Het
Or2y1e T C 11: 49,218,583 (GRCm39) L115P probably damaging Het
Or4c10b T A 2: 89,711,935 (GRCm39) V255E probably benign Het
Or4d5 A T 9: 40,012,283 (GRCm39) F168I probably damaging Het
Or52b4i T A 7: 102,191,761 (GRCm39) M206K possibly damaging Het
Or6d14 A G 6: 116,533,889 (GRCm39) I168V probably benign Het
Or8b3b A T 9: 38,584,776 (GRCm39) M1K probably null Het
Or8c17 G T 9: 38,180,630 (GRCm39) V266L probably benign Het
Or8g18 G A 9: 39,148,946 (GRCm39) T258M probably benign Het
Pabpc2 A T 18: 39,906,792 (GRCm39) H19L possibly damaging Het
Pcdhb9 A T 18: 37,535,028 (GRCm39) K341* probably null Het
Pde4dip T C 3: 97,654,849 (GRCm39) I859M probably benign Het
Pfkfb2 T C 1: 130,634,159 (GRCm39) probably null Het
Pigg C T 5: 108,461,951 (GRCm39) T94M probably damaging Het
Pik3c2b T C 1: 133,028,569 (GRCm39) F1353L probably damaging Het
Prg4 T C 1: 150,336,462 (GRCm39) D87G probably damaging Het
Prkdc A T 16: 15,508,271 (GRCm39) D974V probably damaging Het
Prmt3 A G 7: 49,437,076 (GRCm39) Y217C probably damaging Het
Proser1 A G 3: 53,382,118 (GRCm39) T192A probably damaging Het
Rab3d G A 9: 21,826,060 (GRCm39) T118M probably damaging Het
Rb1cc1 A G 1: 6,314,486 (GRCm39) K386R possibly damaging Het
Rcn2 A G 9: 55,963,534 (GRCm39) D221G probably benign Het
Rhbdl3 T G 11: 80,222,687 (GRCm39) H245Q probably damaging Het
Ribc1 T C X: 150,788,787 (GRCm39) E204G probably damaging Het
Rpap1 G A 2: 119,608,601 (GRCm39) L254F probably damaging Het
Rrp12 A G 19: 41,880,988 (GRCm39) F148L possibly damaging Het
Rusf1 A T 7: 127,871,803 (GRCm39) probably null Het
Setdb1 A T 3: 95,249,109 (GRCm39) I333K probably damaging Het
Simc1 A G 13: 54,694,845 (GRCm39) I1210V probably benign Het
Smchd1 T A 17: 71,686,569 (GRCm39) D1379V probably benign Het
Snap29 A T 16: 17,240,370 (GRCm39) K159* probably null Het
Spdye4c A T 2: 128,436,132 (GRCm39) K176M possibly damaging Het
Stk31 T A 6: 49,400,419 (GRCm39) W415R probably damaging Het
Supt6 C T 11: 78,100,321 (GRCm39) R1497Q probably damaging Het
Tenm3 A G 8: 48,729,191 (GRCm39) I1605T possibly damaging Het
Ttn T C 2: 76,676,967 (GRCm39) probably null Het
Ttn A G 2: 76,728,011 (GRCm39) probably benign Het
Ucp3 A T 7: 100,129,368 (GRCm39) T68S probably benign Het
Ugt2b36 T C 5: 87,237,336 (GRCm39) N316D probably benign Het
Usp4 T G 9: 108,244,003 (GRCm39) S247A probably benign Het
Utp20 A T 10: 88,606,613 (GRCm39) V1653D probably benign Het
Vmn1r183 A G 7: 23,754,250 (GRCm39) I18V probably benign Het
Vmn1r237 A G 17: 21,534,885 (GRCm39) M203V probably damaging Het
Vmn1r61 A T 7: 5,613,998 (GRCm39) F105L possibly damaging Het
Zfp462 T C 4: 55,011,951 (GRCm39) C158R probably damaging Het
Zfyve16 C G 13: 92,657,637 (GRCm39) R758P probably damaging Het
Other mutations in Acnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Acnat2 APN 4 49,383,250 (GRCm39) missense probably damaging 1.00
IGL01321:Acnat2 APN 4 49,380,269 (GRCm39) missense probably damaging 0.99
IGL01891:Acnat2 APN 4 49,383,395 (GRCm39) missense probably benign 0.00
IGL01993:Acnat2 APN 4 49,380,131 (GRCm39) missense probably benign 0.00
IGL02517:Acnat2 APN 4 49,380,647 (GRCm39) missense possibly damaging 0.79
IGL02517:Acnat2 APN 4 49,380,639 (GRCm39) nonsense probably null
IGL03249:Acnat2 APN 4 49,381,787 (GRCm39) missense probably benign 0.00
PIT4494001:Acnat2 UTSW 4 49,383,133 (GRCm39) missense probably benign 0.16
R0050:Acnat2 UTSW 4 49,380,586 (GRCm39) missense probably benign 0.03
R0462:Acnat2 UTSW 4 49,383,084 (GRCm39) critical splice donor site probably null
R0482:Acnat2 UTSW 4 49,383,534 (GRCm39) missense probably benign 0.09
R0590:Acnat2 UTSW 4 49,383,273 (GRCm39) missense probably benign 0.00
R1099:Acnat2 UTSW 4 49,380,484 (GRCm39) missense probably benign 0.01
R1678:Acnat2 UTSW 4 49,380,568 (GRCm39) missense probably damaging 0.98
R1710:Acnat2 UTSW 4 49,380,587 (GRCm39) missense probably benign 0.16
R2190:Acnat2 UTSW 4 49,383,551 (GRCm39) start codon destroyed probably benign
R4863:Acnat2 UTSW 4 49,380,172 (GRCm39) missense probably damaging 1.00
R5031:Acnat2 UTSW 4 49,380,631 (GRCm39) missense probably damaging 1.00
R5194:Acnat2 UTSW 4 49,380,452 (GRCm39) missense probably benign
R5936:Acnat2 UTSW 4 49,383,362 (GRCm39) missense probably benign 0.00
R6451:Acnat2 UTSW 4 49,380,262 (GRCm39) missense probably benign 0.00
R6526:Acnat2 UTSW 4 49,383,497 (GRCm39) missense probably benign 0.00
R6759:Acnat2 UTSW 4 49,380,254 (GRCm39) missense probably benign 0.01
R7180:Acnat2 UTSW 4 49,381,803 (GRCm39) nonsense probably null
R7356:Acnat2 UTSW 4 49,383,507 (GRCm39) missense probably damaging 1.00
R7879:Acnat2 UTSW 4 49,383,299 (GRCm39) missense probably damaging 1.00
R9626:Acnat2 UTSW 4 49,380,179 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCACTCCCTGCACTTTACTCTG -3'
(R):5'- TGATGACACCAATCCATCCGGC -3'

Sequencing Primer
(F):5'- ACTCTGGCACTTTACACACTATTTAG -3'
(R):5'- ATCCAAGTCCATGATTCAGGG -3'
Posted On 2013-07-11