Incidental Mutation 'R7527:Nuf2'
ID583034
Institutional Source Beutler Lab
Gene Symbol Nuf2
Ensembl Gene ENSMUSG00000026683
Gene NameNUF2, NDC80 kinetochore complex component
SynonymsNuf2R, Cdca1, 2410003C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R7527 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location169497934-169531464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 169498853 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 443 (E443G)
Ref Sequence ENSEMBL: ENSMUSP00000028000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028000] [ENSMUST00000111368]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028000
AA Change: E443G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028000
Gene: ENSMUSG00000026683
AA Change: E443G

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 9.7e-46 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111368
AA Change: E443G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106999
Gene: ENSMUSG00000026683
AA Change: E443G

DomainStartEndE-ValueType
Pfam:Nuf2 3 146 6.5e-37 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to yeast Nuf2, a component of a conserved protein complex associated with the centromere. Yeast Nuf2 disappears from the centromere during meiotic prophase when centromeres lose their connection to the spindle pole body, and plays a regulatory role in chromosome segregation. The encoded protein is found to be associated with centromeres of mitotic HeLa cells, which suggests that this protein is a functional homolog of yeast Nuf2. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adam22 T C 5: 8,082,239 H138R possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Man2c1 T A 9: 57,137,816 Y429* probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Slc6a16 T C 7: 45,272,639 W664R probably damaging Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Sptbn4 T C 7: 27,375,590 E1452G possibly damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Trpm2 T C 10: 77,966,060 N57S probably benign Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Uso1 A G 5: 92,199,875 D845G possibly damaging Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Nuf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Nuf2 APN 1 169522435 unclassified probably benign
IGL00980:Nuf2 APN 1 169510434 missense probably damaging 1.00
IGL01131:Nuf2 APN 1 169522364 splice site probably benign
IGL01310:Nuf2 APN 1 169498862 missense probably benign 0.12
IGL01774:Nuf2 APN 1 169506072 missense probably benign
IGL01786:Nuf2 APN 1 169510483 missense possibly damaging 0.88
IGL01866:Nuf2 APN 1 169498838 missense possibly damaging 0.68
IGL02134:Nuf2 APN 1 169513500 missense probably benign
IGL02955:Nuf2 APN 1 169507238 splice site probably benign
R0350:Nuf2 UTSW 1 169513543 critical splice acceptor site probably null
R0390:Nuf2 UTSW 1 169525297 unclassified probably benign
R0479:Nuf2 UTSW 1 169498934 splice site probably benign
R0578:Nuf2 UTSW 1 169510549 splice site probably benign
R0765:Nuf2 UTSW 1 169522936 unclassified probably benign
R1351:Nuf2 UTSW 1 169510549 splice site probably benign
R1564:Nuf2 UTSW 1 169498793 missense unknown
R3747:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3748:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3749:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R4601:Nuf2 UTSW 1 169506114 missense probably damaging 1.00
R4815:Nuf2 UTSW 1 169510468 missense probably damaging 1.00
R5473:Nuf2 UTSW 1 169507287 missense probably benign 0.05
R5522:Nuf2 UTSW 1 169498884 missense probably damaging 1.00
R5716:Nuf2 UTSW 1 169522389 missense probably benign 0.23
R5742:Nuf2 UTSW 1 169516622 missense probably damaging 1.00
R6583:Nuf2 UTSW 1 169504548 missense probably benign
R6680:Nuf2 UTSW 1 169515009 splice site probably null
R7068:Nuf2 UTSW 1 169522419 missense probably damaging 1.00
R7099:Nuf2 UTSW 1 169506072 missense probably benign
R7186:Nuf2 UTSW 1 169525385 missense probably damaging 0.99
R7578:Nuf2 UTSW 1 169504528 missense probably benign 0.00
R7836:Nuf2 UTSW 1 169525329 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACTAGTGGTACCCGTGTTAGTG -3'
(R):5'- ATCAGCTGTAGTCGTTGGTCC -3'

Sequencing Primer
(F):5'- GAGCTGATATTGCAGGTACTTCC -3'
(R):5'- TCCTGGGTAGAAAAGATCTAAGCTC -3'
Posted On2019-10-17