Incidental Mutation 'R7527:Adam22'
ID583050
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7527 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8082239 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 138 (H138R)
Ref Sequence ENSEMBL: ENSMUSP00000142580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115386] [ENSMUST00000115388] [ENSMUST00000123168] [ENSMUST00000126384] [ENSMUST00000130315] [ENSMUST00000136524] [ENSMUST00000136808] [ENSMUST00000139048] [ENSMUST00000139841] [ENSMUST00000144241] [ENSMUST00000197700] [ENSMUST00000153427] [ENSMUST00000153889] [ENSMUST00000154935]
Predicted Effect silent
Transcript: ENSMUST00000050166
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000088744
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000088761
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000115386
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000115388
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000123168
SMART Domains Protein: ENSMUSP00000122758
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000124121
SMART Domains Protein: ENSMUSP00000122652
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
Blast:ACR 2 52 5e-28 BLAST
EGF 59 93 1.28e1 SMART
transmembrane domain 118 140 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000126384
SMART Domains Protein: ENSMUSP00000118571
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000130315
SMART Domains Protein: ENSMUSP00000121156
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 150 170 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000136524
SMART Domains Protein: ENSMUSP00000116422
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 152 172 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000136808
SMART Domains Protein: ENSMUSP00000122426
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000139048
SMART Domains Protein: ENSMUSP00000116736
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000139841
SMART Domains Protein: ENSMUSP00000115775
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 144 164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144241
SMART Domains Protein: ENSMUSP00000138353
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197700
AA Change: H138R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142580
Gene: ENSMUSG00000040537
AA Change: H138R

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000153427
SMART Domains Protein: ENSMUSP00000120995
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
low complexity region 209 229 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000153889
SMART Domains Protein: ENSMUSP00000123196
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000154935
SMART Domains Protein: ENSMUSP00000119409
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Man2c1 T A 9: 57,137,816 Y429* probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Nuf2 T C 1: 169,498,853 E443G possibly damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Slc6a16 T C 7: 45,272,639 W664R probably damaging Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Sptbn4 T C 7: 27,375,590 E1452G possibly damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Trpm2 T C 10: 77,966,060 N57S probably benign Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Uso1 A G 5: 92,199,875 D845G possibly damaging Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
R7402:Adam22 UTSW 5 8095049 missense possibly damaging 0.95
R7431:Adam22 UTSW 5 8092818 missense probably damaging 1.00
R7571:Adam22 UTSW 5 8082160 nonsense probably null
R7627:Adam22 UTSW 5 8367933 missense probably benign
R7678:Adam22 UTSW 5 8087750 splice site probably null
R7714:Adam22 UTSW 5 8117587 critical splice donor site probably null
R7806:Adam22 UTSW 5 8092825 missense probably damaging 1.00
R7834:Adam22 UTSW 5 8130535 missense probably damaging 1.00
R7837:Adam22 UTSW 5 8149284 critical splice acceptor site probably null
R7979:Adam22 UTSW 5 8136804 critical splice donor site probably null
R8123:Adam22 UTSW 5 8092833 critical splice acceptor site probably null
R8511:Adam22 UTSW 5 8134558 missense probably damaging 0.98
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTTTCAAAGTAGAAAACCCAGCTC -3'
(R):5'- AGCATTCCAGTTTCAGAATGACAG -3'

Sequencing Primer
(F):5'- GTTGAATCCAGTCTGGGCTACATAAC -3'
(R):5'- GTTTCAGAATGACAGTTGCACCC -3'
Posted On2019-10-17