Incidental Mutation 'R7527:Uso1'
ID583053
Institutional Source Beutler Lab
Gene Symbol Uso1
Ensembl Gene ENSMUSG00000029407
Gene NameUSO1 vesicle docking factor
SynonymsVdp, TAP, transcytosis associated protein p115
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7527 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location92137938-92202798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92199875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 845 (D845G)
Ref Sequence ENSEMBL: ENSMUSP00000031355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031355
AA Change: D845G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: D845G

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 6.5e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
Pfam:Uso1_p115_C 782 954 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201642
SMART Domains Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
PDB:3GRL|A 1 52 5e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000202155
AA Change: D783G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407
AA Change: D783G

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 5.7e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Pfam:Uso1_p115_C 730 892 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adam22 T C 5: 8,082,239 H138R possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Man2c1 T A 9: 57,137,816 Y429* probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Nuf2 T C 1: 169,498,853 E443G possibly damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Slc6a16 T C 7: 45,272,639 W664R probably damaging Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Sptbn4 T C 7: 27,375,590 E1452G possibly damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Trpm2 T C 10: 77,966,060 N57S probably benign Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Uso1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Uso1 APN 5 92181419 missense probably damaging 0.96
IGL01753:Uso1 APN 5 92152918 critical splice donor site probably null
IGL02311:Uso1 APN 5 92187776 missense probably benign
IGL02539:Uso1 APN 5 92187773 missense probably damaging 1.00
IGL02716:Uso1 APN 5 92173935 missense probably damaging 0.99
IGL03154:Uso1 APN 5 92180618 nonsense probably null
R0558:Uso1 UTSW 5 92174019 missense probably benign 0.03
R0570:Uso1 UTSW 5 92199823 missense probably benign 0.19
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1398:Uso1 UTSW 5 92181468 missense probably benign 0.16
R1485:Uso1 UTSW 5 92180563 missense possibly damaging 0.76
R1813:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1873:Uso1 UTSW 5 92192859 splice site probably benign
R1896:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1899:Uso1 UTSW 5 92201192 missense probably benign 0.27
R2049:Uso1 UTSW 5 92181936 missense probably damaging 1.00
R2128:Uso1 UTSW 5 92195370 missense probably benign
R2411:Uso1 UTSW 5 92158399 splice site probably benign
R2903:Uso1 UTSW 5 92195435 critical splice donor site probably null
R5055:Uso1 UTSW 5 92192735 missense probably benign 0.31
R5155:Uso1 UTSW 5 92167335 critical splice donor site probably null
R5590:Uso1 UTSW 5 92180608 missense probably benign 0.05
R5665:Uso1 UTSW 5 92198337 missense possibly damaging 0.95
R5677:Uso1 UTSW 5 92201299 missense probably damaging 1.00
R5996:Uso1 UTSW 5 92192730 missense probably benign 0.00
R6165:Uso1 UTSW 5 92187267 missense probably damaging 1.00
R6340:Uso1 UTSW 5 92199852 missense probably benign 0.01
R6701:Uso1 UTSW 5 92166585 missense probably damaging 1.00
R6860:Uso1 UTSW 5 92195348 missense probably benign 0.11
R7062:Uso1 UTSW 5 92192740 missense possibly damaging 0.62
R7133:Uso1 UTSW 5 92158465 missense probably benign 0.12
R7317:Uso1 UTSW 5 92173992 missense possibly damaging 0.70
R7648:Uso1 UTSW 5 92194002 splice site probably null
R7707:Uso1 UTSW 5 92201936 makesense probably null
R8009:Uso1 UTSW 5 92166580 missense probably benign 0.03
R8104:Uso1 UTSW 5 92158421 missense probably damaging 0.99
R8361:Uso1 UTSW 5 92189262 missense probably null 0.00
Z1177:Uso1 UTSW 5 92138130 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCAGAGTGCATTCTGTTGC -3'
(R):5'- CCATTAGCCAAAGTTGTTACCC -3'

Sequencing Primer
(F):5'- CAGAGTGCATTCTGTTGCTTTCG -3'
(R):5'- AATCCTGGCACTCAGTAGGTG -3'
Posted On2019-10-17