Mutagenetix > Incidental Mutations

Incidental Mutation 'R0616:Kmt2c'

58306

Institutional Source

Beutler Lab

Gene Symbol

Kmt2c

Ensembl Gene

ENSMUSG00000038056

Gene Name

lysine (K)-specific methyltransferase 2C

Synonyms

Mll3, E330008K23Rik, HALR

MMRRC Submission

038805-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0616 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25271798-25498783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25299252 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 275 (I275T)

Ref Sequence

ENSEMBL: ENSMUSP00000133482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000174734]

Predicted Effect

probably benign
Transcript: ENSMUST00000045291
AA Change: I3686T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: I3686T

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	898	910	1.41e2	SMART
PHD	953	1002	2.89e-10	SMART
RING	954	1001	4.74e0	SMART
C1	994	1045	8.38e-2	SMART
PHD	1003	1049	1.05e-12	SMART
PHD	1080	1131	2.08e-2	SMART
low complexity region	1189	1201	N/A	INTRINSIC
low complexity region	1337	1348	N/A	INTRINSIC
low complexity region	1394	1406	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1520	1539	N/A	INTRINSIC
low complexity region	1557	1570	N/A	INTRINSIC
HMG	1639	1703	2.64e-3	SMART
low complexity region	1708	1724	N/A	INTRINSIC
coiled coil region	1745	1789	N/A	INTRINSIC
low complexity region	1847	1860	N/A	INTRINSIC
low complexity region	1864	1891	N/A	INTRINSIC
internal_repeat_3	1893	2084	1.27e-14	PROSPERO
internal_repeat_3	2123	2306	1.27e-14	PROSPERO
low complexity region	2336	2348	N/A	INTRINSIC
low complexity region	2375	2394	N/A	INTRINSIC
low complexity region	2427	2440	N/A	INTRINSIC
low complexity region	2516	2527	N/A	INTRINSIC
low complexity region	2696	2720	N/A	INTRINSIC
low complexity region	2723	2742	N/A	INTRINSIC
low complexity region	2930	2943	N/A	INTRINSIC
coiled coil region	3048	3075	N/A	INTRINSIC
low complexity region	3156	3165	N/A	INTRINSIC
low complexity region	3173	3195	N/A	INTRINSIC
coiled coil region	3226	3270	N/A	INTRINSIC
low complexity region	3277	3290	N/A	INTRINSIC
coiled coil region	3389	3427	N/A	INTRINSIC
low complexity region	3460	3486	N/A	INTRINSIC
low complexity region	3597	3611	N/A	INTRINSIC
low complexity region	3649	3667	N/A	INTRINSIC
low complexity region	3769	3783	N/A	INTRINSIC
low complexity region	3822	3827	N/A	INTRINSIC
low complexity region	3860	3869	N/A	INTRINSIC
low complexity region	3887	3904	N/A	INTRINSIC
low complexity region	3994	4009	N/A	INTRINSIC
low complexity region	4015	4038	N/A	INTRINSIC
low complexity region	4293	4309	N/A	INTRINSIC
low complexity region	4412	4419	N/A	INTRINSIC
PHD	4454	4500	2.94e-2	SMART
RING	4455	4499	8.1e0	SMART
FYRN	4554	4597	1.18e-21	SMART
FYRC	4603	4690	4.54e-32	SMART
SET	4764	4886	3.17e-34	SMART
PostSET	4888	4904	1.82e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000172556
AA Change: I604T

SMART Domains

Protein: ENSMUSP00000133941
Gene: ENSMUSG00000038056
AA Change: I604T

Domain	Start	End	E-Value	Type
SCOP:d2spca_	84	177	1e-3	SMART
low complexity region	196	209	N/A	INTRINSIC
coiled coil region	307	345	N/A	INTRINSIC
low complexity region	379	405	N/A	INTRINSIC
low complexity region	516	530	N/A	INTRINSIC
low complexity region	568	586	N/A	INTRINSIC
low complexity region	688	702	N/A	INTRINSIC
low complexity region	735	752	N/A	INTRINSIC
low complexity region	842	857	N/A	INTRINSIC
low complexity region	863	886	N/A	INTRINSIC
low complexity region	1141	1157	N/A	INTRINSIC
low complexity region	1260	1267	N/A	INTRINSIC
PHD	1302	1348	2.94e-2	SMART
FYRN	1402	1445	1.18e-21	SMART
FYRC	1451	1538	4.54e-32	SMART
SET	1608	1730	3.17e-34	SMART
PostSET	1732	1748	1.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174734
AA Change: I275T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133482
Gene: ENSMUSG00000038056
AA Change: I275T

Domain	Start	End	E-Value	Type
low complexity region	49	75	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
low complexity region	358	372	N/A	INTRINSIC
low complexity region	411	416	N/A	INTRINSIC
low complexity region	449	458	N/A	INTRINSIC
low complexity region	614	629	N/A	INTRINSIC
low complexity region	635	658	N/A	INTRINSIC
low complexity region	913	929	N/A	INTRINSIC
low complexity region	1032	1039	N/A	INTRINSIC
PHD	1074	1120	2.94e-2	SMART
FYRN	1174	1217	1.18e-21	SMART
FYRC	1223	1310	4.54e-32	SMART
SET	1384	1506	3.17e-34	SMART
PostSET	1508	1524	1.82e-6	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	G	T	14: 49,773,656	T198K	possibly damaging	Het
Abca12	G	T	1: 71,302,671	Q1044K	probably damaging	Het
Abi3bp	A	T	16: 56,654,070	T723S	probably damaging	Het
Ackr3	G	A	1: 90,214,469	V217I	probably benign	Het
Acnat2	A	G	4: 49,380,269	S370P	probably damaging	Het
Arap1	A	G	7: 101,401,650	R1152G	possibly damaging	Het
Arhgap15	G	A	2: 44,116,717		probably null	Het
Arhgap5	C	T	12: 52,517,065	T273I	possibly damaging	Het
BC017158	A	T	7: 128,272,631		probably null	Het
C1s2	T	C	6: 124,628,764	E332G	probably damaging	Het
Camp	G	A	9: 109,848,639	R88W	probably benign	Het
Cdkl2	A	G	5: 92,009,004	M564T	probably benign	Het
Ceacam20	A	G	7: 19,970,396	H124R	probably benign	Het
Cep19	C	T	16: 32,104,011	R32C	probably damaging	Het
Cep295	G	A	9: 15,332,322	Q1565*	probably null	Het
Chd3	T	C	11: 69,345,487	E1932G	probably damaging	Het
Cnr2	G	T	4: 135,917,562	W317L	probably benign	Het
Cntnap5a	C	T	1: 116,580,549	H1264Y	possibly damaging	Het
Depdc7	T	A	2: 104,727,305	N200I	probably benign	Het
Dock4	T	C	12: 40,704,415	S468P	probably benign	Het
Dscc1	C	A	15: 55,083,570	C253F	probably benign	Het
Fam126a	T	C	5: 23,986,772	T44A	probably damaging	Het
Fam217a	C	A	13: 34,913,683	S55I	probably benign	Het
Fam92a	G	A	4: 12,168,234	R210*	probably null	Het
Farp1	G	A	14: 121,277,022	R921H	probably damaging	Het
Fat4	A	G	3: 38,942,870	D1746G	probably damaging	Het
Fbxw5	T	C	2: 25,502,505	F100L	probably damaging	Het
Gli3	C	A	13: 15,662,406	T458K	possibly damaging	Het
Gm4841	T	C	18: 60,270,937	Y28C	probably benign	Het
Gprc5d	T	C	6: 135,116,432	E159G	probably benign	Het
Grm4	A	T	17: 27,434,564	I757N	probably damaging	Het
Hagh	A	G	17: 24,857,577	Y94C	probably damaging	Het
Itpkb	T	C	1: 180,421,736	I892T	probably damaging	Het
Kcmf1	T	C	6: 72,850,484	I58V	probably benign	Het
Khdrbs2	A	G	1: 32,467,775	I167V	possibly damaging	Het
Lingo4	A	G	3: 94,403,081	K442R	probably benign	Het
Mak	T	C	13: 41,042,185	N382D	probably benign	Het
Maob	G	A	X: 16,710,163	T480I	possibly damaging	Het
Mcoln1	A	G	8: 3,515,025	E573G	probably benign	Het
Ms4a6b	G	A	19: 11,526,898		probably null	Het
Muc5ac	A	G	7: 141,796,244	M576V	probably benign	Het
Nme8	T	A	13: 19,690,859	D126V	probably benign	Het
Npy2r	T	A	3: 82,541,363	D35V	possibly damaging	Het
Nrxn1	T	C	17: 90,362,857	D193G	probably damaging	Het
Olfr1257	T	A	2: 89,881,591	V255E	probably benign	Het
Olfr130	A	C	17: 38,067,240	E23A	probably damaging	Het
Olfr1391	T	C	11: 49,327,756	L115P	probably damaging	Het
Olfr1537	G	A	9: 39,237,650	T258M	probably benign	Het
Olfr214	A	G	6: 116,556,928	I168V	probably benign	Het
Olfr548-ps1	T	A	7: 102,542,554	M206K	possibly damaging	Het
Olfr895	G	T	9: 38,269,334	V266L	probably benign	Het
Olfr918	A	T	9: 38,673,480	M1K	probably null	Het
Olfr984	A	T	9: 40,100,987	F168I	probably damaging	Het
Pabpc2	A	T	18: 39,773,739	H19L	possibly damaging	Het
Pcdhb9	A	T	18: 37,401,975	K341*	probably null	Het
Pde4dip	T	C	3: 97,747,533	I859M	probably benign	Het
Pfkfb2	T	C	1: 130,706,422		probably null	Het
Pigg	C	T	5: 108,314,085	T94M	probably damaging	Het
Pik3c2b	T	C	1: 133,100,831	F1353L	probably damaging	Het
Prg4	T	C	1: 150,460,711	D87G	probably damaging	Het
Prkdc	A	T	16: 15,690,407	D974V	probably damaging	Het
Prmt3	A	G	7: 49,787,328	Y217C	probably damaging	Het
Proser1	A	G	3: 53,474,697	T192A	probably damaging	Het
Rab3d	G	A	9: 21,914,764	T118M	probably damaging	Het
Rb1cc1	A	G	1: 6,244,262	K386R	possibly damaging	Het
Rcn2	A	G	9: 56,056,250	D221G	probably benign	Het
Rhbdl3	T	G	11: 80,331,861	H245Q	probably damaging	Het
Ribc1	T	C	X: 152,005,791	E204G	probably damaging	Het
Rpap1	G	A	2: 119,778,120	L254F	probably damaging	Het
Rrp12	A	G	19: 41,892,549	F148L	possibly damaging	Het
Setdb1	A	T	3: 95,341,798	I333K	probably damaging	Het
Simc1	A	G	13: 54,547,032	I1210V	probably benign	Het
Smchd1	T	A	17: 71,379,574	D1379V	probably benign	Het
Snap29	A	T	16: 17,422,506	K159*	probably null	Het
Spdye4c	A	T	2: 128,594,212	K176M	possibly damaging	Het
Stk31	T	A	6: 49,423,485	W415R	probably damaging	Het
Supt6	C	T	11: 78,209,495	R1497Q	probably damaging	Het
Tenm3	A	G	8: 48,276,156	I1605T	possibly damaging	Het
Ttn	T	C	2: 76,846,623		probably null	Het
Ttn	A	G	2: 76,897,667		probably benign	Het
Ucp3	A	T	7: 100,480,161	T68S	probably benign	Het
Ugt2b36	T	C	5: 87,089,477	N316D	probably benign	Het
Usp4	T	G	9: 108,366,804	S247A	probably benign	Het
Utp20	A	T	10: 88,770,751	V1653D	probably benign	Het
Vmn1r183	A	G	7: 24,054,825	I18V	probably benign	Het
Vmn1r237	A	G	17: 21,314,623	M203V	probably damaging	Het
Vmn1r61	A	T	7: 5,610,999	F105L	possibly damaging	Het
Zfp462	T	C	4: 55,011,951	C158R	probably damaging	Het
Zfyve16	C	G	13: 92,521,129	R758P	probably damaging	Het

Other mutations in Kmt2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Kmt2c	APN	5	25281261	missense	probably damaging	0.99
IGL00694:Kmt2c	APN	5	25293161	missense	probably damaging	0.99
IGL00780:Kmt2c	APN	5	25311051	missense	probably benign	0.00
IGL00811:Kmt2c	APN	5	25374533	missense	possibly damaging	0.75
IGL00885:Kmt2c	APN	5	25409171	missense	possibly damaging	0.80
IGL00948:Kmt2c	APN	5	25377161	missense	probably benign	0.08
IGL00959:Kmt2c	APN	5	25276229	missense	probably damaging	1.00
IGL01022:Kmt2c	APN	5	25302701	unclassified	probably benign
IGL01146:Kmt2c	APN	5	25308512	missense	probably damaging	0.96
IGL01154:Kmt2c	APN	5	25284399	missense	probably damaging	1.00
IGL01434:Kmt2c	APN	5	25409308	missense	probably damaging	1.00
IGL01464:Kmt2c	APN	5	25352244	missense	possibly damaging	0.90
IGL01525:Kmt2c	APN	5	25329441	splice site	probably benign
IGL01530:Kmt2c	APN	5	25313500	missense	probably benign	0.08
IGL01550:Kmt2c	APN	5	25281276	missense	probably damaging	1.00
IGL01598:Kmt2c	APN	5	25273666	makesense	probably null
IGL01598:Kmt2c	APN	5	25354771	missense	probably damaging	1.00
IGL01608:Kmt2c	APN	5	25354811	missense	probably damaging	0.97
IGL01663:Kmt2c	APN	5	25310670	missense	probably damaging	1.00
IGL01707:Kmt2c	APN	5	25300098	missense	probably damaging	1.00
IGL01714:Kmt2c	APN	5	25313400	missense	probably benign
IGL01784:Kmt2c	APN	5	25313526	missense	probably damaging	1.00
IGL01813:Kmt2c	APN	5	25290804	missense	possibly damaging	0.82
IGL01825:Kmt2c	APN	5	25310596	missense	probably damaging	1.00
IGL01834:Kmt2c	APN	5	25395455	missense	probably benign	0.05
IGL02072:Kmt2c	APN	5	25405432	missense	possibly damaging	0.96
IGL02159:Kmt2c	APN	5	25311343	missense	probably benign	0.18
IGL02303:Kmt2c	APN	5	25310157	missense	probably damaging	0.96
IGL02417:Kmt2c	APN	5	25373020	missense	probably benign
IGL02578:Kmt2c	APN	5	25366200	intron	probably benign
IGL02811:Kmt2c	APN	5	25315028	nonsense	probably null
IGL02943:Kmt2c	APN	5	25290823	missense	probably damaging	1.00
IGL03000:Kmt2c	APN	5	25284172	missense	probably damaging	1.00
IGL03040:Kmt2c	APN	5	25310352	missense	probably benign
IGL03076:Kmt2c	APN	5	25299151	nonsense	probably null
IGL03088:Kmt2c	APN	5	25299804	missense	probably damaging	0.99
IGL03131:Kmt2c	APN	5	25315361	missense	probably benign	0.00
FR4304:Kmt2c	UTSW	5	25315766	small insertion	probably benign
FR4976:Kmt2c	UTSW	5	25315763	small insertion	probably benign
PIT4520001:Kmt2c	UTSW	5	25315666	missense	probably benign	0.12
PIT4585001:Kmt2c	UTSW	5	25315106	missense	probably benign	0.21
R0313:Kmt2c	UTSW	5	25344930	missense	probably damaging	1.00
R0374:Kmt2c	UTSW	5	25309708	missense	probably damaging	1.00
R0411:Kmt2c	UTSW	5	25375957	missense	probably damaging	1.00
R0422:Kmt2c	UTSW	5	25315664	missense	probably benign
R0453:Kmt2c	UTSW	5	25354747	missense	probably damaging	1.00
R0619:Kmt2c	UTSW	5	25298916	missense	probably benign	0.21
R0671:Kmt2c	UTSW	5	25404365	missense	probably damaging	1.00
R0736:Kmt2c	UTSW	5	25295434	missense	probably benign
R0745:Kmt2c	UTSW	5	25359698	splice site	probably null
R0760:Kmt2c	UTSW	5	25353317	missense	possibly damaging	0.68
R0784:Kmt2c	UTSW	5	25310895	missense	probably benign	0.00
R0882:Kmt2c	UTSW	5	25295607	missense	possibly damaging	0.90
R0893:Kmt2c	UTSW	5	25351270	splice site	probably benign
R0942:Kmt2c	UTSW	5	25315303	missense	probably benign	0.10
R1110:Kmt2c	UTSW	5	25314362	missense	probably benign	0.01
R1137:Kmt2c	UTSW	5	25310983	missense	possibly damaging	0.80
R1255:Kmt2c	UTSW	5	25351153	missense	probably damaging	1.00
R1300:Kmt2c	UTSW	5	25405454	missense	probably damaging	0.99
R1497:Kmt2c	UTSW	5	25314515	missense	possibly damaging	0.80
R1594:Kmt2c	UTSW	5	25314878	missense	probably benign	0.01
R1611:Kmt2c	UTSW	5	25359311	critical splice donor site	probably null
R1617:Kmt2c	UTSW	5	25375927	missense	probably benign	0.01
R1720:Kmt2c	UTSW	5	25299184	missense	probably benign	0.05
R1723:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1724:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1726:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1736:Kmt2c	UTSW	5	25290527	missense	probably damaging	1.00
R1778:Kmt2c	UTSW	5	25372974	missense	probably benign	0.02
R1809:Kmt2c	UTSW	5	25284192	missense	probably damaging	1.00
R1845:Kmt2c	UTSW	5	25373436	missense	probably benign	0.45
R1895:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1946:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1989:Kmt2c	UTSW	5	25498544	missense	possibly damaging	0.93
R2039:Kmt2c	UTSW	5	25329040	missense	possibly damaging	0.53
R2049:Kmt2c	UTSW	5	25285079	missense	probably damaging	1.00
R2079:Kmt2c	UTSW	5	25352280	missense	possibly damaging	0.82
R2080:Kmt2c	UTSW	5	25354717	missense	probably damaging	1.00
R2107:Kmt2c	UTSW	5	25309824	missense	probably benign	0.01
R2186:Kmt2c	UTSW	5	25287112	missense	probably damaging	1.00
R2395:Kmt2c	UTSW	5	25315152	missense	probably benign
R2983:Kmt2c	UTSW	5	25315757	small deletion	probably benign
R3109:Kmt2c	UTSW	5	25275735	missense	probably damaging	1.00
R3500:Kmt2c	UTSW	5	25299479	missense	probably benign	0.02
R3738:Kmt2c	UTSW	5	25405383	missense	probably benign	0.41
R3809:Kmt2c	UTSW	5	25409138	missense	possibly damaging	0.87
R4088:Kmt2c	UTSW	5	25287713	missense	probably benign
R4107:Kmt2c	UTSW	5	25298920	missense	possibly damaging	0.51
R4212:Kmt2c	UTSW	5	25347359	critical splice donor site	probably null
R4376:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4377:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4383:Kmt2c	UTSW	5	25351062	missense	possibly damaging	0.77
R4435:Kmt2c	UTSW	5	25314877	missense	possibly damaging	0.63
R4456:Kmt2c	UTSW	5	25310212	missense	probably benign
R4461:Kmt2c	UTSW	5	25299876	missense	probably benign	0.00
R4519:Kmt2c	UTSW	5	25363477	missense	probably damaging	1.00
R4550:Kmt2c	UTSW	5	25300174	missense	probably damaging	1.00
R4557:Kmt2c	UTSW	5	25300315	missense	probably damaging	1.00
R4610:Kmt2c	UTSW	5	25354384	missense	probably damaging	1.00
R4671:Kmt2c	UTSW	5	25366177	missense	probably damaging	1.00
R4704:Kmt2c	UTSW	5	25314027	nonsense	probably null
R4781:Kmt2c	UTSW	5	25443825	missense	probably damaging	1.00
R4844:Kmt2c	UTSW	5	25315113	missense	probably benign
R4855:Kmt2c	UTSW	5	25314557	missense	probably benign	0.00
R4919:Kmt2c	UTSW	5	25314395	missense	possibly damaging	0.80
R4971:Kmt2c	UTSW	5	25310872	missense	probably benign	0.00
R4983:Kmt2c	UTSW	5	25295511	missense	possibly damaging	0.51
R5012:Kmt2c	UTSW	5	25299712	nonsense	probably null
R5033:Kmt2c	UTSW	5	25314708	missense	probably benign	0.03
R5093:Kmt2c	UTSW	5	25409207	missense	probably benign	0.17
R5125:Kmt2c	UTSW	5	25284381	missense	probably damaging	0.99
R5231:Kmt2c	UTSW	5	25315473	missense	possibly damaging	0.89
R5254:Kmt2c	UTSW	5	25314594	missense	probably benign	0.01
R5396:Kmt2c	UTSW	5	25294734	splice site	probably null
R5415:Kmt2c	UTSW	5	25314701	missense	probably benign	0.21
R5523:Kmt2c	UTSW	5	25299339	missense	probably benign	0.00
R5554:Kmt2c	UTSW	5	25294610	missense	probably damaging	1.00
R5701:Kmt2c	UTSW	5	25314017	missense	probably benign	0.16
R5762:Kmt2c	UTSW	5	25310457	missense	probably benign	0.01
R5819:Kmt2c	UTSW	5	25409132	critical splice donor site	probably null
R5838:Kmt2c	UTSW	5	25284471	missense	probably damaging	1.00
R5912:Kmt2c	UTSW	5	25347469	missense	possibly damaging	0.80
R5951:Kmt2c	UTSW	5	25330803	missense	probably benign	0.15
R5988:Kmt2c	UTSW	5	25311120	missense	probably benign	0.02
R5999:Kmt2c	UTSW	5	25284205	missense	probably damaging	1.00
R6104:Kmt2c	UTSW	5	25299129	missense	probably benign
R6254:Kmt2c	UTSW	5	25349874	missense	possibly damaging	0.94
R6311:Kmt2c	UTSW	5	25443818	critical splice donor site	probably null
R6329:Kmt2c	UTSW	5	25315602	missense	probably benign	0.01
R6347:Kmt2c	UTSW	5	25310835	missense	possibly damaging	0.54
R6364:Kmt2c	UTSW	5	25309636	missense	probably null	0.99
R6379:Kmt2c	UTSW	5	25359341	missense	probably damaging	1.00
R6588:Kmt2c	UTSW	5	25323789	missense	probably damaging	0.99
R6628:Kmt2c	UTSW	5	25298928	missense	probably benign
R6733:Kmt2c	UTSW	5	25409293	missense	probably damaging	1.00
R6787:Kmt2c	UTSW	5	25275739	splice site	probably null
R6816:Kmt2c	UTSW	5	25405532	splice site	probably null
R6862:Kmt2c	UTSW	5	25310517	missense	probably damaging	1.00
R7150:Kmt2c	UTSW	5	25300362	missense	possibly damaging	0.89
R7220:Kmt2c	UTSW	5	25344925	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25299491	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25309807	missense	probably benign	0.00
R7402:Kmt2c	UTSW	5	25395420	missense	probably damaging	1.00
R7465:Kmt2c	UTSW	5	25302849	missense	probably damaging	1.00
R7467:Kmt2c	UTSW	5	25308532	missense	probably damaging	1.00
R7491:Kmt2c	UTSW	5	25284564	missense	probably damaging	0.99
R7549:Kmt2c	UTSW	5	25414970	missense	possibly damaging	0.95
R7637:Kmt2c	UTSW	5	25315095	missense	probably damaging	1.00
R7652:Kmt2c	UTSW	5	25315719	missense	probably benign	0.01
R7714:Kmt2c	UTSW	5	25375366	missense	probably benign
R7838:Kmt2c	UTSW	5	25294699	missense	possibly damaging	0.57
R7891:Kmt2c	UTSW	5	25300111	missense	probably damaging	1.00
R7892:Kmt2c	UTSW	5	25299816	missense	probably benign	0.18
R7895:Kmt2c	UTSW	5	25373176	missense	possibly damaging	0.65
R7960:Kmt2c	UTSW	5	25315196	missense	probably benign	0.01
R7974:Kmt2c	UTSW	5	25300563	missense	probably damaging	1.00
R7978:Kmt2c	UTSW	5	25359678	missense	probably benign	0.00
R8011:Kmt2c	UTSW	5	25351234	missense	probably damaging	0.99
R8021:Kmt2c	UTSW	5	25287119	missense	possibly damaging	0.88
R8022:Kmt2c	UTSW	5	25281680	missense	possibly damaging	0.83
R8079:Kmt2c	UTSW	5	25302732	missense	probably damaging	0.98
R8087:Kmt2c	UTSW	5	25329252	missense	probably damaging	1.00
R8109:Kmt2c	UTSW	5	25281384	missense	probably damaging	1.00
R8161:Kmt2c	UTSW	5	25374564	missense	probably benign	0.00
R8169:Kmt2c	UTSW	5	25354687	missense	probably damaging	1.00
R8206:Kmt2c	UTSW	5	25314539	missense	probably damaging	0.98
R8218:Kmt2c	UTSW	5	25283106	missense	probably damaging	1.00
R8223:Kmt2c	UTSW	5	25324218	missense	possibly damaging	0.89
R8260:Kmt2c	UTSW	5	25405516	missense	possibly damaging	0.87
R8330:Kmt2c	UTSW	5	25304694	missense	probably null	1.00
R8355:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8455:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8508:Kmt2c	UTSW	5	25314122	missense	probably benign	0.34
R8885:Kmt2c	UTSW	5	25315079	missense	probably benign	0.34
R8907:Kmt2c	UTSW	5	25309611	missense	probably damaging	1.00
R8924:Kmt2c	UTSW	5	25298887	missense	probably benign
RF001:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF006:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF011:Kmt2c	UTSW	5	25338459	missense	probably damaging	1.00
RF041:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF047:Kmt2c	UTSW	5	25315760	small insertion	probably benign
RF051:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF055:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF059:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF063:Kmt2c	UTSW	5	25315764	small insertion	probably benign
X0024:Kmt2c	UTSW	5	25405485	missense	probably benign	0.26
X0027:Kmt2c	UTSW	5	25330887	missense	possibly damaging	0.90
Z1176:Kmt2c	UTSW	5	25354413	missense	probably damaging	1.00
Z1177:Kmt2c	UTSW	5	25295397	critical splice donor site	probably null
Z1177:Kmt2c	UTSW	5	25300003	missense	probably benign	0.00
Z1177:Kmt2c	UTSW	5	25366197	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGTATTGAGGAGACAGGACCAGC -3'
(R):5'- GATGCAGAATCCGGCAAAGCAC -3'

Sequencing Primer
(F):5'- CAGGACCAGCTACAATGTCTTTG -3'
(R):5'- ACTGCGCTGCTCCACTAAC -3'

Posted On

2013-07-11