Incidental Mutation 'R7527:Sptbn4'
ID583061
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R7527 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27375590 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1452 (E1452G)
Ref Sequence ENSEMBL: ENSMUSP00000011895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011895
AA Change: E1452G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: E1452G

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108362
AA Change: E132G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: E132G

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108363
AA Change: E132G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: E132G

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108364
AA Change: E132G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: E132G

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172269
AA Change: E1447G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: E1447G

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adam22 T C 5: 8,082,239 H138R possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Man2c1 T A 9: 57,137,816 Y429* probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Nuf2 T C 1: 169,498,853 E443G possibly damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Slc6a16 T C 7: 45,272,639 W664R probably damaging Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Trpm2 T C 10: 77,966,060 N57S probably benign Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Uso1 A G 5: 92,199,875 D845G possibly damaging Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0194:Sptbn4 UTSW 7 27404911 missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1906:Sptbn4 UTSW 7 27391431 critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27423798 missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6762:Sptbn4 UTSW 7 27394208 missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27366689 missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27409014 missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27428268 missense probably benign 0.13
R7528:Sptbn4 UTSW 7 27442535 missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27372272 missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27361577 missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27364336 missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27361634 missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27362410 missense probably benign
R8002:Sptbn4 UTSW 7 27417992 missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27364269 missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27375383 missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27408889 nonsense probably null
R8353:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27372296 missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Z1176:Sptbn4 UTSW 7 27360025 missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27404582 missense probably damaging 1.00
Z1177:Sptbn4 UTSW 7 27409102 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCTTGGATGCCAGCAACAAG -3'
(R):5'- CTGATTGACAAGGGAGGTCTAC -3'

Sequencing Primer
(F):5'- TGCAAAGGCTCCAGCAG -3'
(R):5'- AGTGCCTGGTCACCATAA -3'
Posted On2019-10-17