Incidental Mutation 'R7527:Vmn2r60'
ID583062
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7527 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AG to A at 42195734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect probably null
Transcript: ENSMUST00000166447
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adam22 T C 5: 8,082,239 H138R possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Man2c1 T A 9: 57,137,816 Y429* probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Nuf2 T C 1: 169,498,853 E443G possibly damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Slc6a16 T C 7: 45,272,639 W664R probably damaging Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Sptbn4 T C 7: 27,375,590 E1452G possibly damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Trpm2 T C 10: 77,966,060 N57S probably benign Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Uso1 A G 5: 92,199,875 D845G possibly damaging Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
R7526:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7528:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7764:Vmn2r60 UTSW 7 42195111 missense probably damaging 0.99
R7843:Vmn2r60 UTSW 7 42195087 missense probably benign 0.00
R8080:Vmn2r60 UTSW 7 42141097 missense probably benign 0.30
R8290:Vmn2r60 UTSW 7 42142266 missense probably damaging 1.00
R8342:Vmn2r60 UTSW 7 42141070 missense possibly damaging 0.63
R8362:Vmn2r60 UTSW 7 42195530 missense probably damaging 1.00
R8418:Vmn2r60 UTSW 7 42195426 missense probably damaging 0.97
RF024:Vmn2r60 UTSW 7 42140939 missense probably benign 0.01
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCTGTCATTCAGCATGCAG -3'
(R):5'- CTGTAGGCTAACAAGGGCACAG -3'

Sequencing Primer
(F):5'- CAGCATGCAGATATTCTTCTGTG -3'
(R):5'- TAACAAGGGCACAGAGTAAAACTATG -3'
Posted On2019-10-17