Incidental Mutation 'R7527:Slc6a16'
ID583063
Institutional Source Beutler Lab
Gene Symbol Slc6a16
Ensembl Gene ENSMUSG00000094152
Gene Namesolute carrier family 6, member 16
SynonymsLOC381884
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7527 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45241085-45273367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45272639 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 664 (W664R)
Ref Sequence ENSEMBL: ENSMUSP00000149306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179310] [ENSMUST00000210861] [ENSMUST00000213347]
Predicted Effect probably damaging
Transcript: ENSMUST00000179310
AA Change: W653R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136199
Gene: ENSMUSG00000094152
AA Change: W653R

DomainStartEndE-ValueType
Pfam:SNF 114 668 2.4e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179310
AA Change: W653R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210861
Predicted Effect probably damaging
Transcript: ENSMUST00000213347
AA Change: W664R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC6A16 shows structural characteristics of an Na(+)- and Cl(-)-dependent neurotransmitter transporter, including 12 transmembrane (TM) domains, intracellular N and C termini, and large extracellular loops containing multiple N-glycosylation sites.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adam22 T C 5: 8,082,239 H138R possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Man2c1 T A 9: 57,137,816 Y429* probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Nuf2 T C 1: 169,498,853 E443G possibly damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Sptbn4 T C 7: 27,375,590 E1452G possibly damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Trpm2 T C 10: 77,966,060 N57S probably benign Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Uso1 A G 5: 92,199,875 D845G possibly damaging Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Slc6a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0345:Slc6a16 UTSW 7 45259248 missense possibly damaging 0.50
R1721:Slc6a16 UTSW 7 45261176 missense possibly damaging 0.86
R3788:Slc6a16 UTSW 7 45259962 missense probably benign 0.01
R3854:Slc6a16 UTSW 7 45268172 missense probably damaging 1.00
R5024:Slc6a16 UTSW 7 45259966 missense probably benign 0.02
R5450:Slc6a16 UTSW 7 45261248 missense probably benign 0.33
R5624:Slc6a16 UTSW 7 45261108 missense probably benign 0.00
R5756:Slc6a16 UTSW 7 45260850 missense possibly damaging 0.95
R6224:Slc6a16 UTSW 7 45261148 missense probably damaging 1.00
R6384:Slc6a16 UTSW 7 45257593 splice site probably null
R6736:Slc6a16 UTSW 7 45259028 missense possibly damaging 0.57
R7035:Slc6a16 UTSW 7 45260827 missense probably damaging 1.00
R7525:Slc6a16 UTSW 7 45259113 missense probably benign 0.01
R7681:Slc6a16 UTSW 7 45260914 missense probably damaging 1.00
R7884:Slc6a16 UTSW 7 45259347 missense probably damaging 0.99
R7966:Slc6a16 UTSW 7 45268053 missense possibly damaging 0.92
Z1177:Slc6a16 UTSW 7 45260908 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTCTGTGTCCCTCAACAGG -3'
(R):5'- GCAATCAGGATCTTGGACCAC -3'

Sequencing Primer
(F):5'- ACAGGTTCCTTGCAGACATG -3'
(R):5'- AATCAGGATCTTGGACCACTCTGG -3'
Posted On2019-10-17