Incidental Mutation 'R7527:Man2c1'
ID583075
Institutional Source Beutler Lab
Gene Symbol Man2c1
Ensembl Gene ENSMUSG00000032295
Gene Namemannosidase, alpha, class 2C, member 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7527 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location57130690-57142722 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57137816 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 429 (Y429*)
Ref Sequence ENSEMBL: ENSMUSP00000125478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000159130] [ENSMUST00000160147] [ENSMUST00000160584] [ENSMUST00000161182] [ENSMUST00000161338] [ENSMUST00000161393] [ENSMUST00000161663] [ENSMUST00000162915] [ENSMUST00000190245]
Predicted Effect probably null
Transcript: ENSMUST00000034836
AA Change: Y429*
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295
AA Change: Y429*

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159101
SMART Domains Protein: ENSMUSP00000124304
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 21 100 1.22e-32 SMART
low complexity region 110 120 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159130
Predicted Effect probably null
Transcript: ENSMUST00000160147
AA Change: Y429*
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295
AA Change: Y429*

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160426
SMART Domains Protein: ENSMUSP00000124005
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 24 77 4.48e-1 SMART
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160584
SMART Domains Protein: ENSMUSP00000123840
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161182
AA Change: Y330*
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295
AA Change: Y330*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161338
Predicted Effect probably benign
Transcript: ENSMUST00000161393
Predicted Effect probably null
Transcript: ENSMUST00000161663
AA Change: Y470*
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295
AA Change: Y470*

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162915
Predicted Effect probably benign
Transcript: ENSMUST00000190245
SMART Domains Protein: ENSMUSP00000139917
Gene: ENSMUSG00000032298

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Germ line null mutants display neuronal and glia degeneration, glycogen accumulation, and liver and kidney damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adam22 T C 5: 8,082,239 H138R possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Nuf2 T C 1: 169,498,853 E443G possibly damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Slc6a16 T C 7: 45,272,639 W664R probably damaging Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Sptbn4 T C 7: 27,375,590 E1452G possibly damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Trpm2 T C 10: 77,966,060 N57S probably benign Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Uso1 A G 5: 92,199,875 D845G possibly damaging Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Man2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Man2c1 APN 9 57141819 missense probably benign
IGL01408:Man2c1 APN 9 57141600 missense probably damaging 1.00
IGL01618:Man2c1 APN 9 57141556 unclassified probably benign
IGL01750:Man2c1 APN 9 57140780 critical splice donor site probably null
IGL01796:Man2c1 APN 9 57137960 missense possibly damaging 0.52
IGL02661:Man2c1 APN 9 57137482 missense probably damaging 1.00
IGL03166:Man2c1 APN 9 57139098 missense probably damaging 1.00
IGL03176:Man2c1 APN 9 57140746 missense probably benign 0.05
IGL03209:Man2c1 APN 9 57141830 missense probably benign 0.00
R0014:Man2c1 UTSW 9 57139701 missense probably benign 0.00
R0329:Man2c1 UTSW 9 57141183 missense probably benign 0.40
R0432:Man2c1 UTSW 9 57135597 missense probably damaging 1.00
R1448:Man2c1 UTSW 9 57135219 missense probably benign 0.23
R1616:Man2c1 UTSW 9 57135509 missense probably benign 0.00
R1838:Man2c1 UTSW 9 57137337 missense probably benign 0.07
R2511:Man2c1 UTSW 9 57141388 splice site probably null
R3751:Man2c1 UTSW 9 57140774 missense probably damaging 1.00
R3771:Man2c1 UTSW 9 57140377 unclassified probably benign
R3772:Man2c1 UTSW 9 57140377 unclassified probably benign
R4110:Man2c1 UTSW 9 57136771 missense probably damaging 0.98
R4116:Man2c1 UTSW 9 57140305 critical splice donor site probably null
R4167:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4169:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4170:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4405:Man2c1 UTSW 9 57139083 missense probably damaging 0.98
R4551:Man2c1 UTSW 9 57131161 missense probably damaging 1.00
R4618:Man2c1 UTSW 9 57142155 splice site probably null
R4798:Man2c1 UTSW 9 57141185 nonsense probably null
R4903:Man2c1 UTSW 9 57138956 missense probably benign 0.08
R5030:Man2c1 UTSW 9 57140639 missense probably benign 0.00
R5079:Man2c1 UTSW 9 57136716 missense probably damaging 1.00
R5086:Man2c1 UTSW 9 57131640 missense probably damaging 0.96
R6430:Man2c1 UTSW 9 57131233 missense possibly damaging 0.91
R6695:Man2c1 UTSW 9 57141591 missense probably benign 0.03
R6743:Man2c1 UTSW 9 57135565 missense probably benign 0.41
R7011:Man2c1 UTSW 9 57137833 missense probably damaging 1.00
R7493:Man2c1 UTSW 9 57141128 missense probably damaging 0.98
R7513:Man2c1 UTSW 9 57139399 missense probably benign 0.44
R7540:Man2c1 UTSW 9 57140275 missense probably damaging 1.00
R7760:Man2c1 UTSW 9 57139363 missense probably benign 0.23
R7868:Man2c1 UTSW 9 57137986 missense probably damaging 0.99
R8261:Man2c1 UTSW 9 57139658 missense probably benign 0.17
R8397:Man2c1 UTSW 9 57135499 missense probably benign 0.01
R8429:Man2c1 UTSW 9 57131161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAACCCTTTCCAGAGTGTG -3'
(R):5'- AATCGGTCCAACATGGTCTGTG -3'

Sequencing Primer
(F):5'- CCAGAGTGTGGTAGGCCTG -3'
(R):5'- CCAACATGGTCTGTGTGGGG -3'
Posted On2019-10-17