Incidental Mutation 'R7527:Trpm2'
ID583083
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7527 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77966060 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 57 (N57S)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105399] [ENSMUST00000105401] [ENSMUST00000219997]
Predicted Effect probably benign
Transcript: ENSMUST00000105399
AA Change: N57S

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101038
Gene: ENSMUSG00000009292
AA Change: N57S

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: N57S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: N57S

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219997
AA Change: N57S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T A 1: 136,214,384 D659V possibly damaging Het
Abca5 A T 11: 110,327,730 probably null Het
Abcc10 A G 17: 46,312,904 S810P possibly damaging Het
Adam22 T C 5: 8,082,239 H138R possibly damaging Het
Adcyap1 T A 17: 93,202,829 L95* probably null Het
Adgrl4 C A 3: 151,439,250 T12N probably benign Het
Alpi T C 1: 87,098,955 N438S probably benign Het
Ankrd44 T C 1: 54,648,324 N979D probably benign Het
Ankrd60 A C 2: 173,578,173 S57A probably benign Het
Arfgef3 G A 10: 18,646,629 P550S probably benign Het
Btbd16 A T 7: 130,820,472 D390V probably damaging Het
Cacna2d4 T C 6: 119,271,247 V374A probably benign Het
Cdcp1 A T 9: 123,185,107 F201I probably benign Het
Cdh15 A T 8: 122,862,126 D313V probably damaging Het
Cfap157 A G 2: 32,779,878 L231P possibly damaging Het
Chl1 T G 6: 103,711,201 C1001G probably damaging Het
Cmtr2 A G 8: 110,222,138 H360R probably damaging Het
Csmd1 C T 8: 16,211,718 A922T probably damaging Het
Fam129c C G 8: 71,606,698 C568W probably damaging Het
Fancg C T 4: 43,010,116 probably benign Het
Glt8d2 A T 10: 82,652,569 S356T unknown Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gm3259 A G 5: 95,342,550 D347G probably benign Het
Gm9195 C T 14: 72,473,870 C376Y possibly damaging Het
Gnai3 G A 3: 108,118,377 R129C Het
Golph3 T G 15: 12,343,318 probably null Het
Hist2h2bb T A 3: 96,269,870 V40D possibly damaging Het
Hk1 C A 10: 62,304,782 V105F probably damaging Het
Hoxd8 A G 2: 74,705,657 Y37C probably damaging Het
Jun G T 4: 95,050,997 P92Q probably damaging Het
Klhl14 C T 18: 21,651,540 V277I probably damaging Het
Lrrc51 C T 7: 101,920,636 probably null Het
Man2c1 T A 9: 57,137,816 Y429* probably null Het
Myo18a T A 11: 77,843,580 C1476S probably benign Het
Neb G C 2: 52,176,623 T6155R probably damaging Het
Nuf2 T C 1: 169,498,853 E443G possibly damaging Het
Olfr1164 A T 2: 88,093,610 C109S probably damaging Het
Olfr1211 A G 2: 88,930,090 V75A probably benign Het
Olfr16 C T 1: 172,956,944 H50Y probably benign Het
Olfr851 A G 9: 19,497,389 I214V probably damaging Het
Osmr A G 15: 6,827,122 S515P probably damaging Het
Pik3r5 T C 11: 68,476,351 L84P probably damaging Het
Plcl1 T C 1: 55,697,114 I538T probably damaging Het
Plxnb1 G T 9: 109,100,861 V262L probably damaging Het
Pprc1 T C 19: 46,069,365 S1320P unknown Het
Prap1 G A 7: 140,096,207 probably null Het
Psg23 A T 7: 18,614,774 V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 Y49H probably damaging Het
Ptprr A G 10: 116,251,199 T528A probably benign Het
Rapgef6 T C 11: 54,634,961 S541P unknown Het
Rnf17 A T 14: 56,516,438 D1534V probably damaging Het
Sdk1 T G 5: 141,792,976 S236R possibly damaging Het
Sepsecs A G 5: 52,644,051 M423T possibly damaging Het
Serpina1f T G 12: 103,691,908 Y246S probably benign Het
Sftpb T A 6: 72,305,064 V46E possibly damaging Het
Slc4a1ap G A 5: 31,534,131 V424I probably benign Het
Slc5a4b G A 10: 76,110,908 T10M probably benign Het
Slc6a16 T C 7: 45,272,639 W664R probably damaging Het
Snx8 T C 5: 140,356,072 E138G probably benign Het
Sox6 T C 7: 115,777,173 E108G probably benign Het
Sptan1 A T 2: 29,980,197 I120F probably damaging Het
Sptbn4 T C 7: 27,375,590 E1452G possibly damaging Het
Stac2 T A 11: 98,039,626 E372V probably damaging Het
Taco1 A T 11: 106,071,969 I161F probably damaging Het
Taf1d C A 9: 15,308,837 D127E possibly damaging Het
Tenm2 T A 11: 36,206,976 N482Y probably damaging Het
Tenm3 A G 8: 48,276,600 V1457A possibly damaging Het
Tmem200c A T 17: 68,841,676 H418L probably benign Het
Tmem81 T C 1: 132,508,146 V230A probably benign Het
Tnn C T 1: 160,118,504 V915I possibly damaging Het
Trav8d-2 A T 14: 53,042,697 Y48F possibly damaging Het
Ttn G A 2: 76,768,039 T19510M probably damaging Het
Ubl7 T C 9: 57,912,884 L73P unknown Het
Uso1 A G 5: 92,199,875 D845G possibly damaging Het
Utrn G T 10: 12,401,382 P3397Q possibly damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77936002 missense probably benign 0.06
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
R8427:Trpm2 UTSW 10 77911402 missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77910252 missense probably damaging 1.00
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTGGGGATTCTCAGCCTGG -3'
(R):5'- TCACACAGGCTCATCCTTG -3'

Sequencing Primer
(F):5'- ATTCTCAGCCTGGCATGGACAC -3'
(R):5'- TGTCTCCTGGGCACACAC -3'
Posted On2019-10-17