Incidental Mutation 'R7527:Trpm2'
ID 583083
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms Trrp7, TRPC7, LTRPC2, 9830168K16Rik
MMRRC Submission 045599-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R7527 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 77743556-77805746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77801894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 57 (N57S)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105399] [ENSMUST00000105401] [ENSMUST00000219997]
AlphaFold Q91YD4
Predicted Effect probably benign
Transcript: ENSMUST00000105399
AA Change: N57S

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101038
Gene: ENSMUSG00000009292
AA Change: N57S

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: N57S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: N57S

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219997
AA Change: N57S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,218,556 (GRCm39) probably null Het
Abcc10 A G 17: 46,623,830 (GRCm39) S810P possibly damaging Het
Adam22 T C 5: 8,132,239 (GRCm39) H138R possibly damaging Het
Adcyap1 T A 17: 93,510,257 (GRCm39) L95* probably null Het
Adgrl4 C A 3: 151,144,887 (GRCm39) T12N probably benign Het
Alpi T C 1: 87,026,677 (GRCm39) N438S probably benign Het
Ankrd44 T C 1: 54,687,483 (GRCm39) N979D probably benign Het
Ankrd60 A C 2: 173,419,966 (GRCm39) S57A probably benign Het
Arfgef3 G A 10: 18,522,377 (GRCm39) P550S probably benign Het
Btbd16 A T 7: 130,422,202 (GRCm39) D390V probably damaging Het
Cacna2d4 T C 6: 119,248,208 (GRCm39) V374A probably benign Het
Cdcp1 A T 9: 123,014,172 (GRCm39) F201I probably benign Het
Cdh15 A T 8: 123,588,865 (GRCm39) D313V probably damaging Het
Cfap157 A G 2: 32,669,890 (GRCm39) L231P possibly damaging Het
Chl1 T G 6: 103,688,162 (GRCm39) C1001G probably damaging Het
Cmtr2 A G 8: 110,948,770 (GRCm39) H360R probably damaging Het
Csmd1 C T 8: 16,261,732 (GRCm39) A922T probably damaging Het
Fancg C T 4: 43,010,116 (GRCm39) probably benign Het
Glt8d2 A T 10: 82,488,403 (GRCm39) S356T unknown Het
Gm19410 T A 8: 36,269,386 (GRCm39) C1074S probably damaging Het
Gm9195 C T 14: 72,711,310 (GRCm39) C376Y possibly damaging Het
Gnai3 G A 3: 108,025,693 (GRCm39) R129C Het
Golph3 T G 15: 12,343,404 (GRCm39) probably null Het
H2bc18 T A 3: 96,177,186 (GRCm39) V40D possibly damaging Het
Hk1 C A 10: 62,140,561 (GRCm39) V105F probably damaging Het
Hoxd8 A G 2: 74,536,001 (GRCm39) Y37C probably damaging Het
Inava T A 1: 136,142,122 (GRCm39) D659V possibly damaging Het
Jun G T 4: 94,939,234 (GRCm39) P92Q probably damaging Het
Klhl14 C T 18: 21,784,597 (GRCm39) V277I probably damaging Het
Lrrc51 C T 7: 101,569,843 (GRCm39) probably null Het
Man2c1 T A 9: 57,045,100 (GRCm39) Y429* probably null Het
Myo18a T A 11: 77,734,406 (GRCm39) C1476S probably benign Het
Neb G C 2: 52,066,635 (GRCm39) T6155R probably damaging Het
Niban3 C G 8: 72,059,342 (GRCm39) C568W probably damaging Het
Nuf2 T C 1: 169,326,422 (GRCm39) E443G possibly damaging Het
Or10j5 C T 1: 172,784,511 (GRCm39) H50Y probably benign Het
Or4c15 A G 2: 88,760,434 (GRCm39) V75A probably benign Het
Or5d37 A T 2: 87,923,954 (GRCm39) C109S probably damaging Het
Or7g32 A G 9: 19,408,685 (GRCm39) I214V probably damaging Het
Osmr A G 15: 6,856,603 (GRCm39) S515P probably damaging Het
Pik3r5 T C 11: 68,367,177 (GRCm39) L84P probably damaging Het
Plcl1 T C 1: 55,736,273 (GRCm39) I538T probably damaging Het
Plxnb1 G T 9: 108,929,929 (GRCm39) V262L probably damaging Het
Pprc1 T C 19: 46,057,804 (GRCm39) S1320P unknown Het
Pramel47 A G 5: 95,490,409 (GRCm39) D347G probably benign Het
Prap1 G A 7: 139,676,120 (GRCm39) probably null Het
Psg23 A T 7: 18,348,699 (GRCm39) V36D probably damaging Het
Ptgr1 A G 4: 58,982,887 (GRCm39) Y49H probably damaging Het
Ptprr A G 10: 116,087,104 (GRCm39) T528A probably benign Het
Rapgef6 T C 11: 54,525,787 (GRCm39) S541P unknown Het
Rnf17 A T 14: 56,753,895 (GRCm39) D1534V probably damaging Het
Sdk1 T G 5: 141,778,731 (GRCm39) S236R possibly damaging Het
Sepsecs A G 5: 52,801,393 (GRCm39) M423T possibly damaging Het
Serpina1f T G 12: 103,658,167 (GRCm39) Y246S probably benign Het
Sftpb T A 6: 72,282,048 (GRCm39) V46E possibly damaging Het
Slc4a1ap G A 5: 31,691,475 (GRCm39) V424I probably benign Het
Slc5a4b G A 10: 75,946,742 (GRCm39) T10M probably benign Het
Slc6a16 T C 7: 44,922,063 (GRCm39) W664R probably damaging Het
Snx8 T C 5: 140,341,827 (GRCm39) E138G probably benign Het
Sox6 T C 7: 115,376,408 (GRCm39) E108G probably benign Het
Sptan1 A T 2: 29,870,209 (GRCm39) I120F probably damaging Het
Sptbn4 T C 7: 27,075,015 (GRCm39) E1452G possibly damaging Het
Stac2 T A 11: 97,930,452 (GRCm39) E372V probably damaging Het
Taco1 A T 11: 105,962,795 (GRCm39) I161F probably damaging Het
Taf1d C A 9: 15,220,133 (GRCm39) D127E possibly damaging Het
Tenm2 T A 11: 36,097,803 (GRCm39) N482Y probably damaging Het
Tenm3 A G 8: 48,729,635 (GRCm39) V1457A possibly damaging Het
Tmem200c A T 17: 69,148,671 (GRCm39) H418L probably benign Het
Tmem81 T C 1: 132,435,884 (GRCm39) V230A probably benign Het
Tnn C T 1: 159,946,074 (GRCm39) V915I possibly damaging Het
Trav8d-2 A T 14: 53,280,154 (GRCm39) Y48F possibly damaging Het
Ttn G A 2: 76,598,383 (GRCm39) T19510M probably damaging Het
Ubl7 T C 9: 57,820,167 (GRCm39) L73P unknown Het
Uso1 A G 5: 92,347,734 (GRCm39) D845G possibly damaging Het
Utrn G T 10: 12,277,126 (GRCm39) P3397Q possibly damaging Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,778,749 (GRCm39) splice site probably null
IGL00773:Trpm2 APN 10 77,785,048 (GRCm39) nonsense probably null
IGL00962:Trpm2 APN 10 77,779,750 (GRCm39) splice site probably benign
IGL01093:Trpm2 APN 10 77,768,114 (GRCm39) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,781,659 (GRCm39) splice site probably benign
IGL01301:Trpm2 APN 10 77,759,818 (GRCm39) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,778,830 (GRCm39) nonsense probably null
IGL02175:Trpm2 APN 10 77,773,741 (GRCm39) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,748,503 (GRCm39) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,754,820 (GRCm39) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,765,112 (GRCm39) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,754,743 (GRCm39) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,753,568 (GRCm39) missense probably benign
IGL03405:Trpm2 APN 10 77,801,906 (GRCm39) splice site probably benign
Fugit UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
scusate UTSW 10 77,802,828 (GRCm39) nonsense probably null
temporal UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,759,818 (GRCm39) missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,779,824 (GRCm39) splice site probably benign
R0332:Trpm2 UTSW 10 77,783,822 (GRCm39) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,759,350 (GRCm39) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,765,122 (GRCm39) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,759,398 (GRCm39) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,802,828 (GRCm39) nonsense probably null
R1518:Trpm2 UTSW 10 77,778,839 (GRCm39) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,778,833 (GRCm39) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,778,910 (GRCm39) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,771,709 (GRCm39) splice site probably null
R1673:Trpm2 UTSW 10 77,778,778 (GRCm39) missense probably benign
R1912:Trpm2 UTSW 10 77,781,710 (GRCm39) missense probably benign 0.10
R1932:Trpm2 UTSW 10 77,776,992 (GRCm39) missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77,783,823 (GRCm39) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,761,600 (GRCm39) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,756,305 (GRCm39) nonsense probably null
R2217:Trpm2 UTSW 10 77,777,016 (GRCm39) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,754,798 (GRCm39) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,750,640 (GRCm39) splice site probably benign
R2395:Trpm2 UTSW 10 77,783,714 (GRCm39) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,766,471 (GRCm39) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,770,558 (GRCm39) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,777,008 (GRCm39) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,747,208 (GRCm39) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,768,136 (GRCm39) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,769,476 (GRCm39) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,753,559 (GRCm39) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,765,053 (GRCm39) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,770,902 (GRCm39) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,759,427 (GRCm39) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,781,750 (GRCm39) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,773,972 (GRCm39) missense probably benign 0.05
R4825:Trpm2 UTSW 10 77,777,007 (GRCm39) missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77,768,023 (GRCm39) nonsense probably null
R4943:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,753,626 (GRCm39) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,801,852 (GRCm39) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,759,355 (GRCm39) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,771,795 (GRCm39) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,795,773 (GRCm39) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,767,973 (GRCm39) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,748,470 (GRCm39) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,774,187 (GRCm39) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,801,814 (GRCm39) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,795,734 (GRCm39) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,753,547 (GRCm39) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,770,877 (GRCm39) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77,768,061 (GRCm39) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,750,574 (GRCm39) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,771,725 (GRCm39) missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7036:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7113:Trpm2 UTSW 10 77,783,765 (GRCm39) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,759,848 (GRCm39) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,771,710 (GRCm39) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,759,389 (GRCm39) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,750,568 (GRCm39) missense probably benign
R7571:Trpm2 UTSW 10 77,773,784 (GRCm39) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,773,885 (GRCm39) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,761,623 (GRCm39) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,759,340 (GRCm39) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,783,731 (GRCm39) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,771,836 (GRCm39) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,801,859 (GRCm39) nonsense probably null
R8340:Trpm2 UTSW 10 77,759,458 (GRCm39) nonsense probably null
R8354:Trpm2 UTSW 10 77,769,483 (GRCm39) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,747,236 (GRCm39) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,746,086 (GRCm39) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,768,128 (GRCm39) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,765,122 (GRCm39) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,777,014 (GRCm39) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,785,032 (GRCm39) missense probably damaging 1.00
R9319:Trpm2 UTSW 10 77,778,776 (GRCm39) nonsense probably null
R9381:Trpm2 UTSW 10 77,747,191 (GRCm39) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,747,226 (GRCm39) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,747,224 (GRCm39) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,748,467 (GRCm39) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,766,389 (GRCm39) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,756,320 (GRCm39) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,773,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTGGGGATTCTCAGCCTGG -3'
(R):5'- TCACACAGGCTCATCCTTG -3'

Sequencing Primer
(F):5'- ATTCTCAGCCTGGCATGGACAC -3'
(R):5'- TGTCTCCTGGGCACACAC -3'
Posted On 2019-10-17