Incidental Mutation 'R7528:Prex2'
ID583103
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
SynonymsC030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R7528 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10993465-11303681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11204092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1329 (D1329E)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
Predicted Effect probably damaging
Transcript: ENSMUST00000027056
AA Change: D1329E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: D1329E

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,529,905 E920G probably damaging Het
Acss2 A C 2: 155,557,146 N443H probably damaging Het
Adam3 C A 8: 24,677,263 A71S unknown Het
Agpat3 A G 10: 78,287,912 L38P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amtn C A 5: 88,378,852 probably null Het
App T G 16: 84,978,258 Y497S possibly damaging Het
Bphl T A 13: 34,060,490 Y197N probably damaging Het
Btrc T A 19: 45,503,086 M160K possibly damaging Het
Ccdc181 A C 1: 164,279,958 N70T probably benign Het
Cd55b T C 1: 130,419,736 N113D possibly damaging Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Dnah2 T C 11: 69,500,796 H691R probably damaging Het
Dnajc13 A G 9: 104,178,965 V1579A possibly damaging Het
Dst T A 1: 34,294,522 F5030I probably damaging Het
Eppk1 G A 15: 76,120,108 probably benign Het
Fbxw4 T C 19: 45,660,010 E7G unknown Het
Fos T A 12: 85,475,658 C154S probably damaging Het
Foxh1 A G 15: 76,669,311 V97A probably benign Het
Gmeb1 G A 4: 132,232,050 T231I possibly damaging Het
Golga3 T A 5: 110,212,232 V1112E probably damaging Het
Gprin3 T C 6: 59,354,032 D430G possibly damaging Het
Hpse2 T C 19: 42,813,024 D441G probably damaging Het
Hydin G A 8: 110,380,572 W460* probably null Het
Ifi204 T C 1: 173,751,840 I480V probably benign Het
Impg2 T C 16: 56,260,380 V849A possibly damaging Het
Kars T C 8: 112,011,234 D12G probably benign Het
Klhdc7a A T 4: 139,967,517 Y40N probably damaging Het
Krtap5-3 T C 7: 142,201,482 C19R unknown Het
Macf1 G A 4: 123,432,059 A5217V possibly damaging Het
Mlc1 A T 15: 88,974,507 I146N possibly damaging Het
Myo3a A T 2: 22,266,114 R129* probably null Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Olfr681 T C 7: 105,121,864 Y136H probably damaging Het
Olfr728 A G 14: 50,139,820 V273A possibly damaging Het
Pard3 G A 8: 127,603,165 R1214H probably damaging Het
Phf20 T A 2: 156,303,008 Y845* probably null Het
Pik3c2a A G 7: 116,394,239 I431T probably damaging Het
Plxna2 A G 1: 194,812,156 S1894G probably damaging Het
Ppp1r7 C T 1: 93,354,401 Q225* probably null Het
Ppp4r1 C A 17: 65,813,498 T209K probably damaging Het
Prc1 T C 7: 80,300,435 probably null Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rab24 A T 13: 55,321,108 C87S probably damaging Het
Rnf43 A T 11: 87,732,128 Y558F probably benign Het
Serpinb6e T C 13: 33,832,491 I420V possibly damaging Het
Slain2 C A 5: 72,914,800 S59* probably null Het
Slfn3 A G 11: 83,214,905 D576G probably benign Het
Sptbn4 A G 7: 27,442,535 M11T probably benign Het
Tdh T C 14: 63,494,011 D238G probably damaging Het
Top2b T A 14: 16,395,427 Y337* probably null Het
Trav15-2-dv6-2 A C 14: 53,649,851 Y76S probably benign Het
Vmn1r172 G T 7: 23,659,764 G25C probably damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vps13d T C 4: 145,091,922 E3125G Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp142 T C 1: 74,570,902 T1245A probably benign Het
Zfp960 C T 17: 17,087,563 H180Y possibly damaging Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11186652 missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11170614 missense probably damaging 0.98
IGL01087:Prex2 APN 1 11068104 missense probably benign 0.00
IGL01490:Prex2 APN 1 11184545 splice site probably null
IGL01533:Prex2 APN 1 11186741 nonsense probably null
IGL01661:Prex2 APN 1 11208614 missense probably benign 0.01
IGL01668:Prex2 APN 1 11153645 missense probably benign 0.00
IGL01674:Prex2 APN 1 11170741 missense probably damaging 1.00
IGL01716:Prex2 APN 1 11266054 missense probably benign 0.04
IGL01867:Prex2 APN 1 11098503 missense probably benign 0.11
IGL01954:Prex2 APN 1 11140011 missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11123233 splice site probably benign
IGL02022:Prex2 APN 1 11297739 missense probably benign 0.04
IGL02130:Prex2 APN 1 11112799 missense probably damaging 1.00
IGL02130:Prex2 APN 1 11160162 missense probably damaging 1.00
IGL02221:Prex2 APN 1 11061345 missense probably benign 0.00
IGL02369:Prex2 APN 1 11101169 critical splice donor site probably null
IGL02440:Prex2 APN 1 11153657 missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11204154 missense probably benign
IGL02492:Prex2 APN 1 11123845 missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11142665 missense probably damaging 1.00
IGL03154:Prex2 APN 1 11153633 missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11266067 missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11185175 missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11140265 missense probably benign 0.01
R0042:Prex2 UTSW 1 11080081 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0138:Prex2 UTSW 1 11285043 splice site probably benign
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0208:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0325:Prex2 UTSW 1 11200057 splice site probably null
R0326:Prex2 UTSW 1 11285065 missense probably damaging 1.00
R0390:Prex2 UTSW 1 11089706 splice site probably null
R0492:Prex2 UTSW 1 11186633 splice site probably benign
R0512:Prex2 UTSW 1 11199933 missense probably benign
R0515:Prex2 UTSW 1 11199874 missense probably damaging 0.99
R0894:Prex2 UTSW 1 11181898 missense probably benign
R1259:Prex2 UTSW 1 11289270 missense probably damaging 1.00
R1332:Prex2 UTSW 1 11204091 missense probably damaging 1.00
R1356:Prex2 UTSW 1 11080092 nonsense probably null
R1451:Prex2 UTSW 1 11156259 missense probably benign 0.01
R1488:Prex2 UTSW 1 11193528 missense probably benign 0.05
R1512:Prex2 UTSW 1 11061330 missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11231772 missense probably damaging 0.99
R1667:Prex2 UTSW 1 11186757 missense probably benign
R1678:Prex2 UTSW 1 11285089 missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11089884 splice site probably benign
R1781:Prex2 UTSW 1 11199955 missense probably benign 0.17
R1804:Prex2 UTSW 1 11132342 missense probably damaging 1.00
R1836:Prex2 UTSW 1 11136780 missense probably damaging 1.00
R1899:Prex2 UTSW 1 11162366 nonsense probably null
R1900:Prex2 UTSW 1 11162366 nonsense probably null
R2020:Prex2 UTSW 1 11162312 missense probably damaging 0.98
R2114:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2117:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2436:Prex2 UTSW 1 11266152 missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11208614 missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11169853 missense probably damaging 1.00
R2924:Prex2 UTSW 1 11098487 missense probably damaging 1.00
R2981:Prex2 UTSW 1 11181962 missense probably damaging 1.00
R3430:Prex2 UTSW 1 11149854 missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11156364 splice site probably benign
R3870:Prex2 UTSW 1 11160192 missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11110357 missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11184516 missense probably benign
R4030:Prex2 UTSW 1 11208568 missense probably benign 0.06
R4214:Prex2 UTSW 1 11101159 missense probably damaging 1.00
R4214:Prex2 UTSW 1 11285061 missense probably damaging 1.00
R4242:Prex2 UTSW 1 11156304 missense probably benign 0.06
R4490:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4491:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4492:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4561:Prex2 UTSW 1 11184545 splice site probably null
R4624:Prex2 UTSW 1 11289265 nonsense probably null
R4647:Prex2 UTSW 1 11162285 missense probably damaging 1.00
R4657:Prex2 UTSW 1 11065825 missense probably benign 0.00
R4706:Prex2 UTSW 1 11199988 missense probably damaging 1.00
R4806:Prex2 UTSW 1 11068020 missense probably damaging 1.00
R4900:Prex2 UTSW 1 11149905 splice site probably benign
R4922:Prex2 UTSW 1 11169940 missense probably damaging 1.00
R4961:Prex2 UTSW 1 11098481 missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11266090 nonsense probably null
R5305:Prex2 UTSW 1 11107678 missense probably damaging 1.00
R5307:Prex2 UTSW 1 11200032 missense probably damaging 0.99
R5331:Prex2 UTSW 1 11140011 missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11139980 missense probably damaging 0.99
R5574:Prex2 UTSW 1 11140058 missense probably damaging 1.00
R5979:Prex2 UTSW 1 11132372 missense probably damaging 1.00
R6076:Prex2 UTSW 1 11185950 missense probably benign 0.09
R6160:Prex2 UTSW 1 10993851 missense probably damaging 1.00
R6177:Prex2 UTSW 1 11136777 missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11266012 missense probably benign 0.01
R6293:Prex2 UTSW 1 11162298 missense probably benign
R6335:Prex2 UTSW 1 11110320 missense probably benign 0.13
R6401:Prex2 UTSW 1 11186727 missense probably benign 0.00
R6427:Prex2 UTSW 1 11182031 missense probably damaging 1.00
R6467:Prex2 UTSW 1 11266035 missense probably damaging 1.00
R6564:Prex2 UTSW 1 11101061 splice site probably null
R6734:Prex2 UTSW 1 11080059 missense probably damaging 1.00
R6753:Prex2 UTSW 1 11184456 missense probably damaging 0.98
R6880:Prex2 UTSW 1 11132384 missense probably damaging 1.00
R6973:Prex2 UTSW 1 11112743 missense probably damaging 1.00
R6980:Prex2 UTSW 1 11162263 missense probably benign 0.05
R6987:Prex2 UTSW 1 11170752 missense probably damaging 0.99
R7085:Prex2 UTSW 1 11098588 missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11153609 missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11136793 missense probably benign 0.33
R7319:Prex2 UTSW 1 11162308 missense probably benign 0.10
R7342:Prex2 UTSW 1 11162325 missense probably benign 0.00
R7469:Prex2 UTSW 1 11285069 missense probably damaging 1.00
R7592:Prex2 UTSW 1 11123213 missense probably damaging 1.00
R7650:Prex2 UTSW 1 11149854 missense possibly damaging 0.67
R7695:Prex2 UTSW 1 11162273 missense probably benign 0.00
R7720:Prex2 UTSW 1 11181937 missense possibly damaging 0.47
R7733:Prex2 UTSW 1 11181959 missense probably benign 0.31
R7859:Prex2 UTSW 1 11080050 missense probably damaging 1.00
R8247:Prex2 UTSW 1 11199970 missense probably benign
R8300:Prex2 UTSW 1 11231718 missense possibly damaging 0.49
R8345:Prex2 UTSW 1 11199894 missense possibly damaging 0.65
R8352:Prex2 UTSW 1 11285139 missense probably benign
R8352:Prex2 UTSW 1 11285140 missense probably benign
R8410:Prex2 UTSW 1 11153657 missense possibly damaging 0.94
R8452:Prex2 UTSW 1 11285139 missense probably benign
R8452:Prex2 UTSW 1 11285140 missense probably benign
RF005:Prex2 UTSW 1 11185166 missense possibly damaging 0.47
Z1177:Prex2 UTSW 1 11289252 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTAGGTTCTATCTACAAGCCAGAC -3'
(R):5'- TCTCAAATACAGCCTCTGTCAG -3'

Sequencing Primer
(F):5'- AGTAACCTCCCACTATATAGGATTTC -3'
(R):5'- CAGCCTCTGTCAGTATTAATATTGG -3'
Posted On2019-10-17