Incidental Mutation 'R7528:Ifi204'
ID583109
Institutional Source Beutler Lab
Gene Symbol Ifi204
Ensembl Gene ENSMUSG00000073489
Gene Nameinterferon activated gene 204
Synonymsp204
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7528 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173747293-173766943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173751840 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 480 (I480V)
Ref Sequence ENSEMBL: ENSMUSP00000106845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111214]
Predicted Effect probably benign
Transcript: ENSMUST00000111214
AA Change: I480V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106845
Gene: ENSMUSG00000073489
AA Change: I480V

DomainStartEndE-ValueType
PYRIN 6 84 8.33e-14 SMART
low complexity region 120 154 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:HIN 225 393 6.2e-78 PFAM
Pfam:HIN 429 595 9.8e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,529,905 E920G probably damaging Het
Acss2 A C 2: 155,557,146 N443H probably damaging Het
Adam3 C A 8: 24,677,263 A71S unknown Het
Agpat3 A G 10: 78,287,912 L38P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amtn C A 5: 88,378,852 probably null Het
App T G 16: 84,978,258 Y497S possibly damaging Het
Bphl T A 13: 34,060,490 Y197N probably damaging Het
Btrc T A 19: 45,503,086 M160K possibly damaging Het
Ccdc181 A C 1: 164,279,958 N70T probably benign Het
Cd55b T C 1: 130,419,736 N113D possibly damaging Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Dnah2 T C 11: 69,500,796 H691R probably damaging Het
Dnajc13 A G 9: 104,178,965 V1579A possibly damaging Het
Dst T A 1: 34,294,522 F5030I probably damaging Het
Eppk1 G A 15: 76,120,108 probably benign Het
Fbxw4 T C 19: 45,660,010 E7G unknown Het
Fos T A 12: 85,475,658 C154S probably damaging Het
Foxh1 A G 15: 76,669,311 V97A probably benign Het
Gmeb1 G A 4: 132,232,050 T231I possibly damaging Het
Golga3 T A 5: 110,212,232 V1112E probably damaging Het
Gprin3 T C 6: 59,354,032 D430G possibly damaging Het
Hpse2 T C 19: 42,813,024 D441G probably damaging Het
Hydin G A 8: 110,380,572 W460* probably null Het
Impg2 T C 16: 56,260,380 V849A possibly damaging Het
Kars T C 8: 112,011,234 D12G probably benign Het
Klhdc7a A T 4: 139,967,517 Y40N probably damaging Het
Krtap5-3 T C 7: 142,201,482 C19R unknown Het
Macf1 G A 4: 123,432,059 A5217V possibly damaging Het
Mlc1 A T 15: 88,974,507 I146N possibly damaging Het
Myo3a A T 2: 22,266,114 R129* probably null Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Olfr681 T C 7: 105,121,864 Y136H probably damaging Het
Olfr728 A G 14: 50,139,820 V273A possibly damaging Het
Pard3 G A 8: 127,603,165 R1214H probably damaging Het
Phf20 T A 2: 156,303,008 Y845* probably null Het
Pik3c2a A G 7: 116,394,239 I431T probably damaging Het
Plxna2 A G 1: 194,812,156 S1894G probably damaging Het
Ppp1r7 C T 1: 93,354,401 Q225* probably null Het
Ppp4r1 C A 17: 65,813,498 T209K probably damaging Het
Prc1 T C 7: 80,300,435 probably null Het
Prex2 T G 1: 11,204,092 D1329E probably damaging Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rab24 A T 13: 55,321,108 C87S probably damaging Het
Rnf43 A T 11: 87,732,128 Y558F probably benign Het
Serpinb6e T C 13: 33,832,491 I420V possibly damaging Het
Slain2 C A 5: 72,914,800 S59* probably null Het
Slfn3 A G 11: 83,214,905 D576G probably benign Het
Sptbn4 A G 7: 27,442,535 M11T probably benign Het
Tdh T C 14: 63,494,011 D238G probably damaging Het
Top2b T A 14: 16,395,427 Y337* probably null Het
Trav15-2-dv6-2 A C 14: 53,649,851 Y76S probably benign Het
Vmn1r172 G T 7: 23,659,764 G25C probably damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vps13d T C 4: 145,091,922 E3125G Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp142 T C 1: 74,570,902 T1245A probably benign Het
Zfp960 C T 17: 17,087,563 H180Y possibly damaging Het
Other mutations in Ifi204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Ifi204 APN 1 173759631 splice site probably benign
IGL01922:Ifi204 APN 1 173761722 missense possibly damaging 0.51
IGL02296:Ifi204 APN 1 173749314 missense possibly damaging 0.93
IGL02419:Ifi204 APN 1 173749380 missense possibly damaging 0.71
IGL02505:Ifi204 APN 1 173755654 missense probably benign 0.04
R0938:Ifi204 UTSW 1 173751745 missense possibly damaging 0.85
R1363:Ifi204 UTSW 1 173749296 missense probably benign 0.00
R1834:Ifi204 UTSW 1 173747606 missense unknown
R2031:Ifi204 UTSW 1 173752777 missense probably damaging 1.00
R2254:Ifi204 UTSW 1 173761730 missense possibly damaging 0.95
R2379:Ifi204 UTSW 1 173755993 nonsense probably null
R2408:Ifi204 UTSW 1 173755632 missense possibly damaging 0.80
R3011:Ifi204 UTSW 1 173751651 missense probably benign 0.01
R3617:Ifi204 UTSW 1 173755717 missense possibly damaging 0.51
R3894:Ifi204 UTSW 1 173749208 missense possibly damaging 0.86
R3916:Ifi204 UTSW 1 173755775 missense possibly damaging 0.95
R4656:Ifi204 UTSW 1 173760361 intron probably benign
R4657:Ifi204 UTSW 1 173760361 intron probably benign
R4694:Ifi204 UTSW 1 173749259 missense probably damaging 0.99
R4703:Ifi204 UTSW 1 173760361 intron probably benign
R4704:Ifi204 UTSW 1 173760361 intron probably benign
R4894:Ifi204 UTSW 1 173760242 missense probably damaging 0.98
R4947:Ifi204 UTSW 1 173755750 missense probably damaging 0.98
R5023:Ifi204 UTSW 1 173751740 missense possibly damaging 0.93
R5036:Ifi204 UTSW 1 173752745 missense possibly damaging 0.79
R5119:Ifi204 UTSW 1 173755668 missense probably damaging 1.00
R5194:Ifi204 UTSW 1 173749344 missense possibly damaging 0.86
R5762:Ifi204 UTSW 1 173752759 missense probably damaging 0.98
R6063:Ifi204 UTSW 1 173751657 missense probably benign 0.03
R6808:Ifi204 UTSW 1 173761703 missense probably benign 0.27
R7311:Ifi204 UTSW 1 173759568 missense probably benign 0.26
R7338:Ifi204 UTSW 1 173760137 missense possibly damaging 0.67
R7430:Ifi204 UTSW 1 173755681 missense probably benign 0.43
R8137:Ifi204 UTSW 1 173761622 missense possibly damaging 0.65
R8141:Ifi204 UTSW 1 173755623 missense possibly damaging 0.81
Z1176:Ifi204 UTSW 1 173751628 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- CAAGTATTGCAACGGCTTACC -3'
(R):5'- CTGCTAAGGAAGAAGATCACCATC -3'

Sequencing Primer
(F):5'- GTCCCCCTTGCTTGTGAGAAAAG -3'
(R):5'- TCATGGTCCCAAACAAGTGATG -3'
Posted On2019-10-17