Incidental Mutation 'R7528:Klhdc7a'
ID583117
Institutional Source Beutler Lab
Gene Symbol Klhdc7a
Ensembl Gene ENSMUSG00000078234
Gene Namekelch domain containing 7A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7528 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139960220-139968026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139967517 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 40 (Y40N)
Ref Sequence ENSEMBL: ENSMUSP00000100648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105031]
Predicted Effect probably damaging
Transcript: ENSMUST00000105031
AA Change: Y40N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100648
Gene: ENSMUSG00000078234
AA Change: Y40N

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Kelch 537 585 4.83e-2 SMART
Kelch 586 631 4.98e-4 SMART
low complexity region 756 769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,529,905 E920G probably damaging Het
Acss2 A C 2: 155,557,146 N443H probably damaging Het
Adam3 C A 8: 24,677,263 A71S unknown Het
Agpat3 A G 10: 78,287,912 L38P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amtn C A 5: 88,378,852 probably null Het
App T G 16: 84,978,258 Y497S possibly damaging Het
Bphl T A 13: 34,060,490 Y197N probably damaging Het
Btrc T A 19: 45,503,086 M160K possibly damaging Het
Ccdc181 A C 1: 164,279,958 N70T probably benign Het
Cd55b T C 1: 130,419,736 N113D possibly damaging Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Dnah2 T C 11: 69,500,796 H691R probably damaging Het
Dnajc13 A G 9: 104,178,965 V1579A possibly damaging Het
Dst T A 1: 34,294,522 F5030I probably damaging Het
Eppk1 G A 15: 76,120,108 probably benign Het
Fbxw4 T C 19: 45,660,010 E7G unknown Het
Fos T A 12: 85,475,658 C154S probably damaging Het
Foxh1 A G 15: 76,669,311 V97A probably benign Het
Gmeb1 G A 4: 132,232,050 T231I possibly damaging Het
Golga3 T A 5: 110,212,232 V1112E probably damaging Het
Gprin3 T C 6: 59,354,032 D430G possibly damaging Het
Hpse2 T C 19: 42,813,024 D441G probably damaging Het
Hydin G A 8: 110,380,572 W460* probably null Het
Ifi204 T C 1: 173,751,840 I480V probably benign Het
Impg2 T C 16: 56,260,380 V849A possibly damaging Het
Kars T C 8: 112,011,234 D12G probably benign Het
Krtap5-3 T C 7: 142,201,482 C19R unknown Het
Macf1 G A 4: 123,432,059 A5217V possibly damaging Het
Mlc1 A T 15: 88,974,507 I146N possibly damaging Het
Myo3a A T 2: 22,266,114 R129* probably null Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Olfr681 T C 7: 105,121,864 Y136H probably damaging Het
Olfr728 A G 14: 50,139,820 V273A possibly damaging Het
Pard3 G A 8: 127,603,165 R1214H probably damaging Het
Phf20 T A 2: 156,303,008 Y845* probably null Het
Pik3c2a A G 7: 116,394,239 I431T probably damaging Het
Plxna2 A G 1: 194,812,156 S1894G probably damaging Het
Ppp1r7 C T 1: 93,354,401 Q225* probably null Het
Ppp4r1 C A 17: 65,813,498 T209K probably damaging Het
Prc1 T C 7: 80,300,435 probably null Het
Prex2 T G 1: 11,204,092 D1329E probably damaging Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rab24 A T 13: 55,321,108 C87S probably damaging Het
Rnf43 A T 11: 87,732,128 Y558F probably benign Het
Serpinb6e T C 13: 33,832,491 I420V possibly damaging Het
Slain2 C A 5: 72,914,800 S59* probably null Het
Slfn3 A G 11: 83,214,905 D576G probably benign Het
Sptbn4 A G 7: 27,442,535 M11T probably benign Het
Tdh T C 14: 63,494,011 D238G probably damaging Het
Top2b T A 14: 16,395,427 Y337* probably null Het
Trav15-2-dv6-2 A C 14: 53,649,851 Y76S probably benign Het
Vmn1r172 G T 7: 23,659,764 G25C probably damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vps13d T C 4: 145,091,922 E3125G Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp142 T C 1: 74,570,902 T1245A probably benign Het
Zfp960 C T 17: 17,087,563 H180Y possibly damaging Het
Other mutations in Klhdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhdc7a APN 4 139966925 missense probably benign 0.00
IGL01588:Klhdc7a APN 4 139966946 missense probably damaging 0.98
IGL01593:Klhdc7a APN 4 139966814 missense probably damaging 1.00
IGL01719:Klhdc7a APN 4 139966550 missense probably damaging 1.00
IGL02333:Klhdc7a APN 4 139967156 missense probably benign 0.07
IGL02481:Klhdc7a APN 4 139965810 missense probably benign 0.25
R0153:Klhdc7a UTSW 4 139967271 missense possibly damaging 0.83
R0385:Klhdc7a UTSW 4 139966705 missense probably benign
R1280:Klhdc7a UTSW 4 139965453 missense probably benign 0.01
R1456:Klhdc7a UTSW 4 139965524 missense possibly damaging 0.46
R1837:Klhdc7a UTSW 4 139967070 missense probably benign 0.31
R1838:Klhdc7a UTSW 4 139967070 missense probably benign 0.31
R1987:Klhdc7a UTSW 4 139966024 nonsense probably null
R2172:Klhdc7a UTSW 4 139965810 missense probably benign 0.25
R2220:Klhdc7a UTSW 4 139965453 missense probably benign 0.01
R3154:Klhdc7a UTSW 4 139965713 missense probably benign 0.20
R3155:Klhdc7a UTSW 4 139967189 missense probably benign 0.01
R4242:Klhdc7a UTSW 4 139966721 missense probably benign 0.01
R4349:Klhdc7a UTSW 4 139966277 missense possibly damaging 0.67
R5859:Klhdc7a UTSW 4 139967574 missense probably damaging 0.96
R6316:Klhdc7a UTSW 4 139966802 missense probably benign 0.00
R6342:Klhdc7a UTSW 4 139967059 missense probably benign 0.09
R6755:Klhdc7a UTSW 4 139966475 missense possibly damaging 0.80
R7648:Klhdc7a UTSW 4 139965939 missense possibly damaging 0.66
R7842:Klhdc7a UTSW 4 139967238 missense probably damaging 0.97
R7843:Klhdc7a UTSW 4 139966844 missense possibly damaging 0.87
R7925:Klhdc7a UTSW 4 139967238 missense probably damaging 0.97
R7926:Klhdc7a UTSW 4 139966844 missense possibly damaging 0.87
X0002:Klhdc7a UTSW 4 139966364 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGCTGTAGTCCAGTGAG -3'
(R):5'- AAAGTCACCTCTGCTCCAGC -3'

Sequencing Primer
(F):5'- TGTAGTCCAGTGAGGTCCCAG -3'
(R):5'- TCCACAGCAGGATCCAGG -3'
Posted On2019-10-17