Incidental Mutation 'R7528:Dnajc13'
ID583135
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7528 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104178965 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1579 (V1579A)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably damaging
Transcript: ENSMUST00000035170
AA Change: V1574A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: V1574A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186788
AA Change: V1579A

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: V1579A

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,529,905 E920G probably damaging Het
Acss2 A C 2: 155,557,146 N443H probably damaging Het
Adam3 C A 8: 24,677,263 A71S unknown Het
Agpat3 A G 10: 78,287,912 L38P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amtn C A 5: 88,378,852 probably null Het
App T G 16: 84,978,258 Y497S possibly damaging Het
Bphl T A 13: 34,060,490 Y197N probably damaging Het
Btrc T A 19: 45,503,086 M160K possibly damaging Het
Ccdc181 A C 1: 164,279,958 N70T probably benign Het
Cd55b T C 1: 130,419,736 N113D possibly damaging Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Dnah2 T C 11: 69,500,796 H691R probably damaging Het
Dst T A 1: 34,294,522 F5030I probably damaging Het
Eppk1 G A 15: 76,120,108 probably benign Het
Fbxw4 T C 19: 45,660,010 E7G unknown Het
Fos T A 12: 85,475,658 C154S probably damaging Het
Foxh1 A G 15: 76,669,311 V97A probably benign Het
Gmeb1 G A 4: 132,232,050 T231I possibly damaging Het
Golga3 T A 5: 110,212,232 V1112E probably damaging Het
Gprin3 T C 6: 59,354,032 D430G possibly damaging Het
Hpse2 T C 19: 42,813,024 D441G probably damaging Het
Hydin G A 8: 110,380,572 W460* probably null Het
Ifi204 T C 1: 173,751,840 I480V probably benign Het
Impg2 T C 16: 56,260,380 V849A possibly damaging Het
Kars T C 8: 112,011,234 D12G probably benign Het
Klhdc7a A T 4: 139,967,517 Y40N probably damaging Het
Krtap5-3 T C 7: 142,201,482 C19R unknown Het
Macf1 G A 4: 123,432,059 A5217V possibly damaging Het
Mlc1 A T 15: 88,974,507 I146N possibly damaging Het
Myo3a A T 2: 22,266,114 R129* probably null Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Olfr681 T C 7: 105,121,864 Y136H probably damaging Het
Olfr728 A G 14: 50,139,820 V273A possibly damaging Het
Pard3 G A 8: 127,603,165 R1214H probably damaging Het
Phf20 T A 2: 156,303,008 Y845* probably null Het
Pik3c2a A G 7: 116,394,239 I431T probably damaging Het
Plxna2 A G 1: 194,812,156 S1894G probably damaging Het
Ppp1r7 C T 1: 93,354,401 Q225* probably null Het
Ppp4r1 C A 17: 65,813,498 T209K probably damaging Het
Prc1 T C 7: 80,300,435 probably null Het
Prex2 T G 1: 11,204,092 D1329E probably damaging Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rab24 A T 13: 55,321,108 C87S probably damaging Het
Rnf43 A T 11: 87,732,128 Y558F probably benign Het
Serpinb6e T C 13: 33,832,491 I420V possibly damaging Het
Slain2 C A 5: 72,914,800 S59* probably null Het
Slfn3 A G 11: 83,214,905 D576G probably benign Het
Sptbn4 A G 7: 27,442,535 M11T probably benign Het
Tdh T C 14: 63,494,011 D238G probably damaging Het
Top2b T A 14: 16,395,427 Y337* probably null Het
Trav15-2-dv6-2 A C 14: 53,649,851 Y76S probably benign Het
Vmn1r172 G T 7: 23,659,764 G25C probably damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vps13d T C 4: 145,091,922 E3125G Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp142 T C 1: 74,570,902 T1245A probably benign Het
Zfp960 C T 17: 17,087,563 H180Y possibly damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCATACCTCAGTAGCACTAG -3'
(R):5'- ACACGTAAGACACTGCACTG -3'

Sequencing Primer
(F):5'- GCTACAGCTAGCTTTCGAGCAATG -3'
(R):5'- CGTAAGACACTGCACTGGGTAC -3'
Posted On2019-10-17