Mutagenetix > Incidental Mutation

Incidental Mutation 'R7528:Top2b'

583145

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

045600-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.888) question?

Stock #

R7528 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 16395427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 337 (Y337*)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629]

AlphaFold

Q64511

Predicted Effect

probably null
Transcript: ENSMUST00000017629
AA Change: Y337*

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: Y337*

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	T	C	14: 118,529,905	E920G	probably damaging	Het
Acss2	A	C	2: 155,557,146	N443H	probably damaging	Het
Adam3	C	A	8: 24,677,263	A71S	unknown	Het
Agpat3	A	G	10: 78,287,912	L38P	probably damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amtn	C	A	5: 88,378,852		probably null	Het
App	T	G	16: 84,978,258	Y497S	possibly damaging	Het
Bphl	T	A	13: 34,060,490	Y197N	probably damaging	Het
Btrc	T	A	19: 45,503,086	M160K	possibly damaging	Het
Ccdc181	A	C	1: 164,279,958	N70T	probably benign	Het
Cd55b	T	C	1: 130,419,736	N113D	possibly damaging	Het
Ctrb1	T	A	8: 111,687,151	I194F	probably benign	Het
Dnah2	T	C	11: 69,500,796	H691R	probably damaging	Het
Dnajc13	A	G	9: 104,178,965	V1579A	possibly damaging	Het
Dst	T	A	1: 34,294,522	F5030I	probably damaging	Het
Eppk1	G	A	15: 76,120,108		probably benign	Het
Fbxw4	T	C	19: 45,660,010	E7G	unknown	Het
Fos	T	A	12: 85,475,658	C154S	probably damaging	Het
Foxh1	A	G	15: 76,669,311	V97A	probably benign	Het
Gmeb1	G	A	4: 132,232,050	T231I	possibly damaging	Het
Golga3	T	A	5: 110,212,232	V1112E	probably damaging	Het
Gprin3	T	C	6: 59,354,032	D430G	possibly damaging	Het
Hpse2	T	C	19: 42,813,024	D441G	probably damaging	Het
Hydin	G	A	8: 110,380,572	W460*	probably null	Het
Ifi204	T	C	1: 173,751,840	I480V	probably benign	Het
Impg2	T	C	16: 56,260,380	V849A	possibly damaging	Het
Kars	T	C	8: 112,011,234	D12G	probably benign	Het
Klhdc7a	A	T	4: 139,967,517	Y40N	probably damaging	Het
Krtap5-3	T	C	7: 142,201,482	C19R	unknown	Het
Macf1	G	A	4: 123,432,059	A5217V	possibly damaging	Het
Mlc1	A	T	15: 88,974,507	I146N	possibly damaging	Het
Myo3a	A	T	2: 22,266,114	R129*	probably null	Het
Nsun4	G	T	4: 116,034,194	Y329*	probably null	Het
Olfr681	T	C	7: 105,121,864	Y136H	probably damaging	Het
Olfr728	A	G	14: 50,139,820	V273A	possibly damaging	Het
Pard3	G	A	8: 127,603,165	R1214H	probably damaging	Het
Phf20	T	A	2: 156,303,008	Y845*	probably null	Het
Pik3c2a	A	G	7: 116,394,239	I431T	probably damaging	Het
Plxna2	A	G	1: 194,812,156	S1894G	probably damaging	Het
Ppp1r7	C	T	1: 93,354,401	Q225*	probably null	Het
Ppp4r1	C	A	17: 65,813,498	T209K	probably damaging	Het
Prc1	T	C	7: 80,300,435		probably null	Het
Prex2	T	G	1: 11,204,092	D1329E	probably damaging	Het
Ptch1	C	T	13: 63,511,714	R1375H	probably benign	Het
Rab24	A	T	13: 55,321,108	C87S	probably damaging	Het
Rnf43	A	T	11: 87,732,128	Y558F	probably benign	Het
Serpinb6e	T	C	13: 33,832,491	I420V	possibly damaging	Het
Slain2	C	A	5: 72,914,800	S59*	probably null	Het
Slfn3	A	G	11: 83,214,905	D576G	probably benign	Het
Sptbn4	A	G	7: 27,442,535	M11T	probably benign	Het
Tdh	T	C	14: 63,494,011	D238G	probably damaging	Het
Trav15-2-dv6-2	A	C	14: 53,649,851	Y76S	probably benign	Het
Vmn1r172	G	T	7: 23,659,764	G25C	probably damaging	Het
Vmn2r60	AG	A	7: 42,195,734		probably null	Het
Vps13d	T	C	4: 145,091,922	E3125G		Het
Xkr6	G	T	14: 63,819,161	V430F	probably benign	Het
Zfp142	T	C	1: 74,570,902	T1245A	probably benign	Het
Zfp960	C	T	17: 17,087,563	H180Y	possibly damaging	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCATAGATGTGGTAGTGAATGAG -3'
(R):5'- GGCTGCAGAGTCATGTTTTC -3'

Sequencing Primer
(F):5'- ATGTGGTAGTGAATGAGGAGATTG -3'
(R):5'- CTGCAGAGTCATGTTTTCCTTAG -3'

Posted On

2019-10-17