Incidental Mutation 'R7528:Top2b'
ID583145
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R7528 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 16395427 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 337 (Y337*)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
Predicted Effect probably null
Transcript: ENSMUST00000017629
AA Change: Y337*
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: Y337*

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,529,905 E920G probably damaging Het
Acss2 A C 2: 155,557,146 N443H probably damaging Het
Adam3 C A 8: 24,677,263 A71S unknown Het
Agpat3 A G 10: 78,287,912 L38P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amtn C A 5: 88,378,852 probably null Het
App T G 16: 84,978,258 Y497S possibly damaging Het
Bphl T A 13: 34,060,490 Y197N probably damaging Het
Btrc T A 19: 45,503,086 M160K possibly damaging Het
Ccdc181 A C 1: 164,279,958 N70T probably benign Het
Cd55b T C 1: 130,419,736 N113D possibly damaging Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Dnah2 T C 11: 69,500,796 H691R probably damaging Het
Dnajc13 A G 9: 104,178,965 V1579A possibly damaging Het
Dst T A 1: 34,294,522 F5030I probably damaging Het
Eppk1 G A 15: 76,120,108 probably benign Het
Fbxw4 T C 19: 45,660,010 E7G unknown Het
Fos T A 12: 85,475,658 C154S probably damaging Het
Foxh1 A G 15: 76,669,311 V97A probably benign Het
Gmeb1 G A 4: 132,232,050 T231I possibly damaging Het
Golga3 T A 5: 110,212,232 V1112E probably damaging Het
Gprin3 T C 6: 59,354,032 D430G possibly damaging Het
Hpse2 T C 19: 42,813,024 D441G probably damaging Het
Hydin G A 8: 110,380,572 W460* probably null Het
Ifi204 T C 1: 173,751,840 I480V probably benign Het
Impg2 T C 16: 56,260,380 V849A possibly damaging Het
Kars T C 8: 112,011,234 D12G probably benign Het
Klhdc7a A T 4: 139,967,517 Y40N probably damaging Het
Krtap5-3 T C 7: 142,201,482 C19R unknown Het
Macf1 G A 4: 123,432,059 A5217V possibly damaging Het
Mlc1 A T 15: 88,974,507 I146N possibly damaging Het
Myo3a A T 2: 22,266,114 R129* probably null Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Olfr681 T C 7: 105,121,864 Y136H probably damaging Het
Olfr728 A G 14: 50,139,820 V273A possibly damaging Het
Pard3 G A 8: 127,603,165 R1214H probably damaging Het
Phf20 T A 2: 156,303,008 Y845* probably null Het
Pik3c2a A G 7: 116,394,239 I431T probably damaging Het
Plxna2 A G 1: 194,812,156 S1894G probably damaging Het
Ppp1r7 C T 1: 93,354,401 Q225* probably null Het
Ppp4r1 C A 17: 65,813,498 T209K probably damaging Het
Prc1 T C 7: 80,300,435 probably null Het
Prex2 T G 1: 11,204,092 D1329E probably damaging Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Rab24 A T 13: 55,321,108 C87S probably damaging Het
Rnf43 A T 11: 87,732,128 Y558F probably benign Het
Serpinb6e T C 13: 33,832,491 I420V possibly damaging Het
Slain2 C A 5: 72,914,800 S59* probably null Het
Slfn3 A G 11: 83,214,905 D576G probably benign Het
Sptbn4 A G 7: 27,442,535 M11T probably benign Het
Tdh T C 14: 63,494,011 D238G probably damaging Het
Trav15-2-dv6-2 A C 14: 53,649,851 Y76S probably benign Het
Vmn1r172 G T 7: 23,659,764 G25C probably damaging Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Vps13d T C 4: 145,091,922 E3125G Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp142 T C 1: 74,570,902 T1245A probably benign Het
Zfp960 C T 17: 17,087,563 H180Y possibly damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCATAGATGTGGTAGTGAATGAG -3'
(R):5'- GGCTGCAGAGTCATGTTTTC -3'

Sequencing Primer
(F):5'- ATGTGGTAGTGAATGAGGAGATTG -3'
(R):5'- CTGCAGAGTCATGTTTTCCTTAG -3'
Posted On2019-10-17