Incidental Mutation 'R0616:Vmn1r61'
ID58315
Institutional Source Beutler Lab
Gene Symbol Vmn1r61
Ensembl Gene ENSMUSG00000094313
Gene Namevomeronasal 1 receptor 61
SynonymsGm7186
MMRRC Submission 038805-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0616 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5610251-5612068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5610999 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 105 (F105L)
Ref Sequence ENSEMBL: ENSMUSP00000128012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164880
AA Change: F105L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128012
Gene: ENSMUSG00000094313
AA Change: F105L

DomainStartEndE-ValueType
Pfam:TAS2R 1 294 5.3e-12 PFAM
Pfam:7tm_1 20 279 5e-9 PFAM
Pfam:V1R 31 299 9.5e-21 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,773,656 T198K possibly damaging Het
Abca12 G T 1: 71,302,671 Q1044K probably damaging Het
Abi3bp A T 16: 56,654,070 T723S probably damaging Het
Ackr3 G A 1: 90,214,469 V217I probably benign Het
Acnat2 A G 4: 49,380,269 S370P probably damaging Het
Arap1 A G 7: 101,401,650 R1152G possibly damaging Het
Arhgap15 G A 2: 44,116,717 probably null Het
Arhgap5 C T 12: 52,517,065 T273I possibly damaging Het
BC017158 A T 7: 128,272,631 probably null Het
C1s2 T C 6: 124,628,764 E332G probably damaging Het
Camp G A 9: 109,848,639 R88W probably benign Het
Cdkl2 A G 5: 92,009,004 M564T probably benign Het
Ceacam20 A G 7: 19,970,396 H124R probably benign Het
Cep19 C T 16: 32,104,011 R32C probably damaging Het
Cep295 G A 9: 15,332,322 Q1565* probably null Het
Chd3 T C 11: 69,345,487 E1932G probably damaging Het
Cnr2 G T 4: 135,917,562 W317L probably benign Het
Cntnap5a C T 1: 116,580,549 H1264Y possibly damaging Het
Depdc7 T A 2: 104,727,305 N200I probably benign Het
Dock4 T C 12: 40,704,415 S468P probably benign Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Fam126a T C 5: 23,986,772 T44A probably damaging Het
Fam217a C A 13: 34,913,683 S55I probably benign Het
Fam92a G A 4: 12,168,234 R210* probably null Het
Farp1 G A 14: 121,277,022 R921H probably damaging Het
Fat4 A G 3: 38,942,870 D1746G probably damaging Het
Fbxw5 T C 2: 25,502,505 F100L probably damaging Het
Gli3 C A 13: 15,662,406 T458K possibly damaging Het
Gm4841 T C 18: 60,270,937 Y28C probably benign Het
Gprc5d T C 6: 135,116,432 E159G probably benign Het
Grm4 A T 17: 27,434,564 I757N probably damaging Het
Hagh A G 17: 24,857,577 Y94C probably damaging Het
Itpkb T C 1: 180,421,736 I892T probably damaging Het
Kcmf1 T C 6: 72,850,484 I58V probably benign Het
Khdrbs2 A G 1: 32,467,775 I167V possibly damaging Het
Kmt2c A G 5: 25,299,252 I275T probably benign Het
Lingo4 A G 3: 94,403,081 K442R probably benign Het
Mak T C 13: 41,042,185 N382D probably benign Het
Maob G A X: 16,710,163 T480I possibly damaging Het
Mcoln1 A G 8: 3,515,025 E573G probably benign Het
Ms4a6b G A 19: 11,526,898 probably null Het
Muc5ac A G 7: 141,796,244 M576V probably benign Het
Nme8 T A 13: 19,690,859 D126V probably benign Het
Npy2r T A 3: 82,541,363 D35V possibly damaging Het
Nrxn1 T C 17: 90,362,857 D193G probably damaging Het
Olfr1257 T A 2: 89,881,591 V255E probably benign Het
Olfr130 A C 17: 38,067,240 E23A probably damaging Het
Olfr1391 T C 11: 49,327,756 L115P probably damaging Het
Olfr1537 G A 9: 39,237,650 T258M probably benign Het
Olfr214 A G 6: 116,556,928 I168V probably benign Het
Olfr548-ps1 T A 7: 102,542,554 M206K possibly damaging Het
Olfr895 G T 9: 38,269,334 V266L probably benign Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Olfr984 A T 9: 40,100,987 F168I probably damaging Het
Pabpc2 A T 18: 39,773,739 H19L possibly damaging Het
Pcdhb9 A T 18: 37,401,975 K341* probably null Het
Pde4dip T C 3: 97,747,533 I859M probably benign Het
Pfkfb2 T C 1: 130,706,422 probably null Het
Pigg C T 5: 108,314,085 T94M probably damaging Het
Pik3c2b T C 1: 133,100,831 F1353L probably damaging Het
Prg4 T C 1: 150,460,711 D87G probably damaging Het
Prkdc A T 16: 15,690,407 D974V probably damaging Het
Prmt3 A G 7: 49,787,328 Y217C probably damaging Het
Proser1 A G 3: 53,474,697 T192A probably damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Rb1cc1 A G 1: 6,244,262 K386R possibly damaging Het
Rcn2 A G 9: 56,056,250 D221G probably benign Het
Rhbdl3 T G 11: 80,331,861 H245Q probably damaging Het
Ribc1 T C X: 152,005,791 E204G probably damaging Het
Rpap1 G A 2: 119,778,120 L254F probably damaging Het
Rrp12 A G 19: 41,892,549 F148L possibly damaging Het
Setdb1 A T 3: 95,341,798 I333K probably damaging Het
Simc1 A G 13: 54,547,032 I1210V probably benign Het
Smchd1 T A 17: 71,379,574 D1379V probably benign Het
Snap29 A T 16: 17,422,506 K159* probably null Het
Spdye4c A T 2: 128,594,212 K176M possibly damaging Het
Stk31 T A 6: 49,423,485 W415R probably damaging Het
Supt6 C T 11: 78,209,495 R1497Q probably damaging Het
Tenm3 A G 8: 48,276,156 I1605T possibly damaging Het
Ttn T C 2: 76,846,623 probably null Het
Ttn A G 2: 76,897,667 probably benign Het
Ucp3 A T 7: 100,480,161 T68S probably benign Het
Ugt2b36 T C 5: 87,089,477 N316D probably benign Het
Usp4 T G 9: 108,366,804 S247A probably benign Het
Utp20 A T 10: 88,770,751 V1653D probably benign Het
Vmn1r183 A G 7: 24,054,825 I18V probably benign Het
Vmn1r237 A G 17: 21,314,623 M203V probably damaging Het
Zfp462 T C 4: 55,011,951 C158R probably damaging Het
Zfyve16 C G 13: 92,521,129 R758P probably damaging Het
Other mutations in Vmn1r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Vmn1r61 APN 7 5611203 missense possibly damaging 0.82
IGL02859:Vmn1r61 APN 7 5611289 missense probably benign 0.37
IGL03344:Vmn1r61 APN 7 5610494 missense possibly damaging 0.95
R0189:Vmn1r61 UTSW 7 5610700 missense probably benign 0.03
R0336:Vmn1r61 UTSW 7 5611067 missense probably benign
R1490:Vmn1r61 UTSW 7 5611243 missense probably benign 0.00
R1737:Vmn1r61 UTSW 7 5611061 missense probably benign 0.01
R1755:Vmn1r61 UTSW 7 5611303 nonsense probably null
R1795:Vmn1r61 UTSW 7 5611325 utr 5 prime probably benign
R3929:Vmn1r61 UTSW 7 5611177 missense probably benign 0.01
R4487:Vmn1r61 UTSW 7 5610925 missense possibly damaging 0.76
R4629:Vmn1r61 UTSW 7 5611250 missense probably benign 0.08
R4785:Vmn1r61 UTSW 7 5611125 nonsense probably null
R4785:Vmn1r61 UTSW 7 5611127 missense probably benign
R5108:Vmn1r61 UTSW 7 5610520 missense probably benign
R5305:Vmn1r61 UTSW 7 5610815 missense probably damaging 1.00
R5914:Vmn1r61 UTSW 7 5610530 missense probably damaging 1.00
R6150:Vmn1r61 UTSW 7 5610679 missense probably benign 0.00
R6232:Vmn1r61 UTSW 7 5610851 missense probably damaging 1.00
R6722:Vmn1r61 UTSW 7 5610688 missense possibly damaging 0.55
R7488:Vmn1r61 UTSW 7 5610768 missense possibly damaging 0.56
R7496:Vmn1r61 UTSW 7 5610431 missense probably benign 0.19
R8353:Vmn1r61 UTSW 7 5610887 missense probably benign 0.11
R8453:Vmn1r61 UTSW 7 5610887 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGACCCCAGAGATGGAGCATATCC -3'
(R):5'- CTTGACTGACTCCAGACTGAAACCC -3'

Sequencing Primer
(F):5'- CAGAGATGGAGCATATCCAATTGTC -3'
(R):5'- TGAAACCCATACAGGTCATTCTAATC -3'
Posted On2013-07-11